ID: 1132886194

View in Genome Browser
Species Human (GRCh38)
Location 16:2183294-2183316
Sequence ACTCACATGCAGACTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 137}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132886194_1132886203 4 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886203 16:2183321-2183343 GTGCTTGGAGGCTTGGTGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 319
1132886194_1132886205 6 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886205 16:2183323-2183345 GCTTGGAGGCTTGGTGGCTGGGG 0: 1
1: 0
2: 4
3: 46
4: 417
1132886194_1132886200 -8 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886200 16:2183309-2183331 ATGTGAGTGGCAGTGCTTGGAGG 0: 1
1: 0
2: 1
3: 35
4: 311
1132886194_1132886204 5 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886204 16:2183322-2183344 TGCTTGGAGGCTTGGTGGCTGGG 0: 1
1: 0
2: 3
3: 30
4: 307
1132886194_1132886207 16 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886207 16:2183333-2183355 TTGGTGGCTGGGGGTCCCTGTGG 0: 1
1: 0
2: 3
3: 37
4: 363
1132886194_1132886208 17 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886208 16:2183334-2183356 TGGTGGCTGGGGGTCCCTGTGGG 0: 1
1: 0
2: 4
3: 51
4: 386
1132886194_1132886209 18 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886209 16:2183335-2183357 GGTGGCTGGGGGTCCCTGTGGGG 0: 1
1: 1
2: 2
3: 71
4: 530
1132886194_1132886202 0 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886202 16:2183317-2183339 GGCAGTGCTTGGAGGCTTGGTGG 0: 1
1: 0
2: 2
3: 37
4: 311
1132886194_1132886201 -3 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886201 16:2183314-2183336 AGTGGCAGTGCTTGGAGGCTTGG 0: 1
1: 0
2: 3
3: 21
4: 287
1132886194_1132886206 7 Left 1132886194 16:2183294-2183316 CCCCCTACAGTCTGCATGTGAGT 0: 1
1: 0
2: 2
3: 10
4: 137
Right 1132886206 16:2183324-2183346 CTTGGAGGCTTGGTGGCTGGGGG 0: 1
1: 0
2: 1
3: 41
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132886194 Original CRISPR ACTCACATGCAGACTGTAGG GGG (reversed) Intronic
900788314 1:4663555-4663577 CCTCAAATGCAGGCTGCAGGTGG + Intronic
904661472 1:32088613-32088635 ACTCACATGTAGGGTGGAGGAGG + Intronic
909763005 1:79316770-79316792 AATCAAATGCAGACTGCAGCTGG + Intergenic
911733738 1:101315334-101315356 AATCACATGGAAACAGTAGGAGG - Intergenic
912916376 1:113818843-113818865 CGCCACATGCAGACTGTAGGTGG - Intronic
915723506 1:158001487-158001509 ACACACATGAAGACTGCTGGTGG + Intronic
923404865 1:233649820-233649842 ACAAACATTCAGACTGTAGCAGG + Intronic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1064288562 10:14013422-14013444 CCTCACCTCCAGGCTGTAGGAGG + Intronic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1067771850 10:49132112-49132134 ACGCACGTGCAGACTGTGCGGGG - Exonic
1071007866 10:80903517-80903539 ATTCTCATGTACACTGTAGGTGG - Intergenic
1073034838 10:100556621-100556643 ATGACCATGCAGACTGTAGGTGG - Exonic
1075090959 10:119444018-119444040 CCTCACATCCAGCCTGTGGGGGG + Intronic
1076107707 10:127836450-127836472 ACTCACATGCAGAATGGAAATGG + Intergenic
1078594981 11:12677999-12678021 ATTCACATACAGACAGTAGGTGG + Intronic
1079005590 11:16789395-16789417 ACACACATGCACACTCTAGTTGG + Intronic
1080337185 11:31210874-31210896 ACTCACATTCACACGGTAAGAGG + Intronic
1082063674 11:47881659-47881681 ATTCAGATGCAGATTCTAGGCGG + Intergenic
1084931466 11:72559929-72559951 ACTCAACTGAAGACTGAAGGAGG - Intergenic
1087150309 11:94853989-94854011 TCTCACATGCAGACTGCAGCTGG - Exonic
1087745103 11:101935011-101935033 ACTCACATGCACAATGCTGGAGG - Intronic
1087753037 11:102026325-102026347 ACTCACCTGCAGACTCAAAGTGG + Intergenic
1091087683 11:132738613-132738635 CCTCACATGGACACTGTAGAAGG - Intronic
1091243543 11:134070876-134070898 ATTCACATGCAGAGCGTAGGAGG + Intronic
1093369595 12:18351857-18351879 ACTGTCTTGAAGACTGTAGGTGG - Intronic
1095237392 12:39813754-39813776 ACTCACATTGAGATTGTAGATGG - Intronic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1098196869 12:68011636-68011658 ACTCAAATGCAGACTGAACTTGG + Intergenic
1098203024 12:68077179-68077201 ACTCACTTGAACACTGGAGGCGG + Intergenic
1102569491 12:113818883-113818905 ACACACAGTCAGACTGCAGGAGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106231740 13:27826034-27826056 ACTCACAGGAAGAGTGAAGGAGG + Intergenic
1107088240 13:36448537-36448559 ACACACATTCTGACTGCAGGGGG + Intergenic
1109479355 13:62928639-62928661 ACTAACATGCACACTGCTGGTGG - Intergenic
1115520429 14:34228190-34228212 TATCAGAAGCAGACTGTAGGTGG - Intronic
1118710175 14:68512352-68512374 ACTGACAAGCAAACCGTAGGAGG - Intronic
1118914932 14:70094854-70094876 ACTCACATGGATACTGTATGAGG - Intronic
1119448544 14:74687900-74687922 ACTCCCATGCAGACTGTTCAGGG - Intronic
1123104250 14:105830702-105830724 GCTCCCATGCAAACTGAAGGTGG + Intergenic
1125278376 15:38017681-38017703 ACTCAGATGCAGTGAGTAGGTGG - Intergenic
1126431151 15:48586359-48586381 AGTCACTTCCTGACTGTAGGAGG - Intronic
1132886194 16:2183294-2183316 ACTCACATGCAGACTGTAGGGGG - Intronic
1136640620 16:31561897-31561919 ATTCCCATGAAGACTGTACGAGG - Intergenic
1136664343 16:31795397-31795419 ATTCCCATGAAGACTGTACGAGG + Intergenic
1142899607 17:3003985-3004007 ACTCTAATGCAGGCTGGAGGAGG + Intronic
1143123844 17:4628072-4628094 GCTCTGATGCAGAGTGTAGGAGG + Intergenic
1143426299 17:6841810-6841832 GCTCTGATGCAGAGTGTAGGAGG - Intergenic
1144617504 17:16790027-16790049 AGTCACATGGAGACTTTAGATGG + Intronic
1144895199 17:18525655-18525677 AGTCACATGGAGACTTTAGATGG - Exonic
1145137024 17:20418576-20418598 AGTCACATGGAGACTTTAGATGG + Intergenic
1152914184 17:83024476-83024498 CCTCACTTGGAGACTGGAGGCGG - Intronic
1154091598 18:11369082-11369104 ACTCAACTGTACACTGTAGGAGG - Intergenic
1154124140 18:11674581-11674603 TCTGAAATGCAGACTGAAGGTGG + Intergenic
1155917646 18:31572179-31572201 AATCTCATGCAGGCTGCAGGGGG - Intergenic
1157312640 18:46563546-46563568 ACAAACATGCAAACTGTAGCAGG - Intronic
1158414625 18:57238849-57238871 ACTCACACACAGACTGTAAATGG + Intergenic
1160018230 18:75160149-75160171 ACACAAATGCAGACGGTAGGAGG + Intergenic
1161707782 19:5830091-5830113 ACACACATGCACACTGTGGCAGG - Intergenic
1162301448 19:9847373-9847395 GCCAGCATGCAGACTGTAGGTGG + Intronic
1164752152 19:30664949-30664971 ACTCTCATGGAGCCTCTAGGAGG - Intronic
1165197985 19:34121045-34121067 ACTCCCATTTAGAATGTAGGAGG + Intergenic
1168199941 19:54807119-54807141 ACTCACATGCAGGATGTAAAAGG - Intronic
1168312600 19:55468425-55468447 ACCCCCATCCAGATTGTAGGGGG - Intergenic
926446330 2:12947140-12947162 TCTCACATGGAGACTGTAAATGG + Intergenic
932135715 2:69226864-69226886 ACTCATATTGAGACTGTAAGAGG - Intronic
932303927 2:70688029-70688051 TCTCACATGCAGCCTGCAGGTGG + Exonic
932770275 2:74497213-74497235 TCTCCCAGGCAGACAGTAGGTGG + Intergenic
936040639 2:109146713-109146735 ACTCAGATGTAGACTCTATGGGG - Intronic
937856268 2:126674054-126674076 ACTCACAGGCAGGCTGTATGTGG + Intronic
943410528 2:187541357-187541379 AGTCAGATGCTCACTGTAGGTGG - Intronic
943655378 2:190503182-190503204 ACTCACCTGCAGAGTGTAAAGGG - Intronic
948014509 2:234677084-234677106 ACTCAGATGCAGACTGCAGATGG - Intergenic
948528528 2:238588369-238588391 TCTCCCATGCAGGCTGTAGTGGG - Intergenic
1170158657 20:13291071-13291093 GCTCACATCCAGACTCAAGGTGG + Intronic
1172143381 20:32739933-32739955 ACTCACTTGAACCCTGTAGGCGG + Intronic
1172210443 20:33194268-33194290 ACTCACAGACAGTCTGAAGGAGG - Intergenic
1175869881 20:62203859-62203881 CCACACATGCTGACTGTGGGGGG - Intergenic
1176337125 21:5609639-5609661 ACTCTCATGCATACTGTATAGGG + Intergenic
1176470787 21:7104865-7104887 ACTCTCATGCATACTGTATAGGG + Intergenic
1176494348 21:7486643-7486665 ACTCTCATGCATACTGTATAGGG + Intergenic
1176506294 21:7651740-7651762 ACTCTCATGCATACTGTATAGGG - Intergenic
1176952264 21:15062739-15062761 ACTAACAAACAGACTCTAGGTGG + Intronic
1178869031 21:36356206-36356228 AAGCATATACAGACTGTAGGTGG - Intronic
1179368678 21:40783412-40783434 ACACACATGCAGATAGTAGCAGG - Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
949369631 3:3320102-3320124 ACTAACATGCAGAAAGAAGGTGG - Intergenic
949777740 3:7651326-7651348 ACTCAAATGAATACTGAAGGAGG - Intronic
949818589 3:8089952-8089974 AGTCACATGAAGAATGGAGGTGG + Intergenic
952287607 3:31983217-31983239 ATTGACATACAGACTGAAGGTGG + Intronic
954661666 3:52229914-52229936 ACTCACCTACAGACTCAAGGGGG + Exonic
956343064 3:68248052-68248074 ACTTAGTTGCAGACTGTTGGGGG + Intronic
957488257 3:80891244-80891266 ACTCACAGCCAGACTGGAAGTGG + Intergenic
958416442 3:93879906-93879928 ACTAACATGCAAGCTCTAGGAGG + Intronic
959195387 3:103174051-103174073 ACTCATACTCAGAATGTAGGGGG + Intergenic
959860348 3:111208666-111208688 GCTCACATCCAGACTGAGGGAGG - Intronic
966169218 3:177059099-177059121 ACTAAAAGGCAGACTGAAGGCGG + Intronic
973968429 4:56186955-56186977 ACTCACAGGGAGACTGAAGTGGG + Intronic
977271555 4:94923330-94923352 ATTCACATCCCAACTGTAGGTGG - Intronic
978587783 4:110292271-110292293 ACCCACATACAGGCTGTCGGGGG - Intergenic
979684323 4:123495019-123495041 AGGCACATGGAGACTCTAGGGGG + Intergenic
981010591 4:139921219-139921241 ACTCACATCCAGACTCCAAGTGG + Intronic
983643695 4:169968376-169968398 ATTCACATCCAGAATGTATGAGG - Intergenic
987881207 5:23748931-23748953 ACTCCCATGCAAATGGTAGGAGG - Intergenic
989480883 5:41928677-41928699 ACTGAAATTCAGACTGTAAGTGG + Intronic
991490179 5:67175006-67175028 ACACACATACACACAGTAGGTGG - Intergenic
992180193 5:74188508-74188530 ACTCACATGGTGAACGTAGGTGG + Intergenic
995999379 5:118340703-118340725 ACAAACATTCAGACTGTAGCAGG - Intergenic
996402449 5:123076831-123076853 ACAAACATCCAAACTGTAGGAGG + Intergenic
996634291 5:125671383-125671405 GGCCACATGCAGGCTGTAGGAGG - Intergenic
997731963 5:136188072-136188094 ATTCAGATGAAGACTGAAGGAGG + Intronic
1002564642 5:180103428-180103450 ACTCACATGAAATATGTAGGTGG - Intronic
1007543807 6:42675211-42675233 ACTGCCATGCAGACAGCAGGAGG + Intronic
1007608107 6:43130701-43130723 ACACACATGCATTCTGTAGAAGG + Intronic
1009399807 6:63241061-63241083 ACTCAGCTGAAGACTGGAGGAGG - Intergenic
1014652053 6:124051961-124051983 CCTCCCAGGCAGTCTGTAGGAGG - Intronic
1015232871 6:130936846-130936868 CCTCACGTTAAGACTGTAGGAGG - Intronic
1033432486 7:141301767-141301789 GCTCACAAGCAGTCTGTTGGTGG - Intronic
1034574545 7:151985793-151985815 ACTCACATCCAGGATGTAGGAGG - Intronic
1035466056 7:159078572-159078594 ACTCAAATGCAGACTTTCGTTGG - Intronic
1036010917 8:4722173-4722195 ACACACATGCTGACTATGGGAGG + Intronic
1037961063 8:23098728-23098750 ACACACATGCAAACTGTATCAGG + Intronic
1038477418 8:27877948-27877970 GGTCACATCCAGACTGGAGGTGG - Intronic
1041840498 8:62264900-62264922 ACTCTCATGAAGACTCTTGGAGG + Intronic
1042290452 8:67165616-67165638 AGTCAAATCCAGACTGGAGGAGG - Intronic
1042347130 8:67739179-67739201 ACTCACAGGCAGACTGTATGGGG - Intronic
1042629122 8:70797217-70797239 ACACACATGCACATTTTAGGTGG + Intergenic
1043288923 8:78571383-78571405 ACTGAAATGCTGAGTGTAGGGGG - Intronic
1046210266 8:111063337-111063359 ACTAACATCAAGACAGTAGGTGG + Intergenic
1047684475 8:127290871-127290893 AGTGGCATGCAGAGTGTAGGAGG - Intergenic
1047747877 8:127858486-127858508 ACTCACATGCATTCTGCAGAAGG - Intergenic
1049052026 8:140205766-140205788 GCTGAGATGGAGACTGTAGGAGG - Intronic
1049602524 8:143514502-143514524 ACTGACATGCACACGGTGGGCGG + Intronic
1050104549 9:2152024-2152046 AATTACATGGAGACTATAGGAGG + Intronic
1050951593 9:11602373-11602395 ACACACACACACACTGTAGGGGG - Intergenic
1051156653 9:14155383-14155405 ACTAACGTGCAGAGTGTAGAGGG - Intronic
1055026748 9:71730042-71730064 ACTCACATACAGTCAGTAGCAGG + Exonic
1056255807 9:84798345-84798367 ACACACATTCAGACCATAGGAGG + Intronic
1056395473 9:86177188-86177210 ACTCACTTGAACTCTGTAGGTGG + Intergenic
1059345929 9:113627947-113627969 ACCCCCATGGAGGCTGTAGGGGG + Intergenic
1061094230 9:128445286-128445308 ACATACATCCAGACTGTAGCGGG - Intergenic
1062613397 9:137385252-137385274 ACTCAAATGTCCACTGTAGGAGG + Intronic
1190220533 X:48509597-48509619 ACCCACATGCACACAGTTGGTGG + Intronic
1191875072 X:65787772-65787794 ACTCCCATGCAGAGTGAAGATGG + Intergenic
1195707090 X:107745097-107745119 ACTCACATGCTGGCTTTGGGTGG - Intronic
1196622122 X:117835687-117835709 ACTCAGATACAGATTCTAGGAGG - Intergenic
1197570412 X:128144021-128144043 ACTAACATCCAGACTCTATGAGG + Intergenic
1198157218 X:133973065-133973087 ACTTACATCCAAAGTGTAGGAGG + Intronic
1198812506 X:140549841-140549863 ATTCACATACAGAGTGTAGTTGG - Intergenic
1199476478 X:148251960-148251982 ACACACATGCATACTCTTGGGGG - Intergenic