ID: 1132888125

View in Genome Browser
Species Human (GRCh38)
Location 16:2191335-2191357
Sequence CAGTCCCAGCCACTGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 406}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132888119_1132888125 -7 Left 1132888119 16:2191319-2191341 CCTGCTGCCCCGGCCTCAGTCCC 0: 1
1: 0
2: 8
3: 72
4: 638
Right 1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG 0: 1
1: 0
2: 5
3: 27
4: 406
1132888114_1132888125 5 Left 1132888114 16:2191307-2191329 CCCACAGCAGCCCCTGCTGCCCC 0: 1
1: 2
2: 9
3: 112
4: 878
Right 1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG 0: 1
1: 0
2: 5
3: 27
4: 406
1132888118_1132888125 -6 Left 1132888118 16:2191318-2191340 CCCTGCTGCCCCGGCCTCAGTCC 0: 1
1: 0
2: 5
3: 44
4: 419
Right 1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG 0: 1
1: 0
2: 5
3: 27
4: 406
1132888117_1132888125 -5 Left 1132888117 16:2191317-2191339 CCCCTGCTGCCCCGGCCTCAGTC 0: 1
1: 0
2: 5
3: 52
4: 505
Right 1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG 0: 1
1: 0
2: 5
3: 27
4: 406
1132888115_1132888125 4 Left 1132888115 16:2191308-2191330 CCACAGCAGCCCCTGCTGCCCCG 0: 1
1: 0
2: 10
3: 109
4: 859
Right 1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG 0: 1
1: 0
2: 5
3: 27
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132888125 Original CRISPR CAGTCCCAGCCACTGGACAC AGG Intronic
900161465 1:1226118-1226140 CAGCTCCAGCCACGGGAGACAGG + Intronic
900244982 1:1632524-1632546 CCCTCCCAACAACTGGACACAGG - Intronic
900256213 1:1699683-1699705 CCCTCCCAACAACTGGACACAGG - Intronic
900319028 1:2073390-2073412 CATTCACAGCCTCTGGACGCAGG + Intronic
900964504 1:5948423-5948445 CAATCCCAGCCACTGGCCTTGGG + Intronic
902393292 1:16118772-16118794 CAATCCCAGCATCTGGGCACAGG - Intergenic
902475942 1:16687491-16687513 CAGTCCCAGCCTTGTGACACTGG - Intergenic
902983399 1:20141129-20141151 CAGTCCAAGCCACTGGTTAGGGG + Intronic
903440760 1:23386355-23386377 TAGTCCCAGCTACTGGATGCGGG - Intronic
903462448 1:23529377-23529399 CACTCCCTGCCAGTGGACTCAGG - Intronic
903554779 1:24185600-24185622 CAGTCCCAGCTAGAGGACACAGG - Intronic
903685459 1:25128475-25128497 GAGTCCCACCCACTGGGGACGGG - Intergenic
903766402 1:25737610-25737632 TAGACCCAGCCACTGCACCCTGG + Intronic
905183052 1:36178331-36178353 CAGTCCCAGGCCCAGAACACAGG + Intronic
905536401 1:38725656-38725678 CTGTTCCAGCCAATGGAAACTGG + Intergenic
905681936 1:39879532-39879554 TAGTCCCAGCTACTTGAGACAGG + Intronic
905689032 1:39929105-39929127 CAGCCTCAGCCACTGGTCAATGG - Intergenic
905863096 1:41363146-41363168 CAGTGCCAGCCAGTGGAAAGGGG + Intronic
906883696 1:49621309-49621331 CCGTTCCAGCCAATGGAAACCGG - Intronic
906961286 1:50420860-50420882 CAGTCGCGGCGACTGGACACGGG + Intronic
907123938 1:52032959-52032981 CAGTCCCAGCCCCTCGCCTCCGG - Exonic
908493471 1:64670181-64670203 TAGTCCCAGCTACTTGAGACTGG + Intronic
911022244 1:93400586-93400608 TAGTCCCAGCCACTGGGCTGAGG + Intergenic
911032545 1:93505386-93505408 CCGTTCCAGCCAATGGAAACTGG - Intronic
911283096 1:95955819-95955841 CCGTTCCAGCCAATGGAAACCGG + Intergenic
912388813 1:109287407-109287429 TAGTCCCAGCCACTTGAGGCAGG - Intergenic
912438987 1:109684029-109684051 CCGTTCCAGCCAGTGGAAACTGG + Intronic
912441509 1:109702474-109702496 CCGTTCCAGCCAGTGGAAACTGG + Intronic
912467928 1:109886707-109886729 CAGTCCCAGGTTCTGGAAACTGG + Intergenic
912483988 1:110009374-110009396 CAGTCCTACCAACTGGGCACTGG - Intronic
912725609 1:112056805-112056827 CAGTCCAAGCCACTCCCCACAGG + Intergenic
912726982 1:112067411-112067433 GGGTCCCAGCCACTGCACTCAGG - Intergenic
913437596 1:118863386-118863408 CAGTCCCAGCCAATGGATGCAGG - Intergenic
913612201 1:120519379-120519401 CAGTCCCAGCCTCGTGACCCTGG - Intergenic
913675291 1:121134922-121134944 CTGTCCCTGCCACTCAACACAGG + Intergenic
914027127 1:143922541-143922563 CTGTCCCTGCCACTCAACACAGG + Intergenic
914195685 1:145446884-145446906 CAGCCCCAGCCCCAGAACACGGG + Intergenic
914578988 1:149002859-149002881 CAGTCCCAGCCTCGTGACCCTGG + Exonic
914971604 1:152311694-152311716 CAGTCAGAGACAGTGGACACTGG - Exonic
915083116 1:153365665-153365687 CACTCCCAGACACAGGAGACAGG + Intergenic
916605893 1:166342871-166342893 CAGTCCCATCCACTGCCCAAGGG - Intergenic
917789210 1:178488580-178488602 CAGACTCCTCCACTGGACACCGG - Intergenic
918451172 1:184660852-184660874 CAGGCCCAGCCAGTGGAGCCTGG + Intergenic
920462652 1:206153759-206153781 CTGTCCCTGCCACTCAACACAGG + Intergenic
921997435 1:221436573-221436595 CTGTGCCAGCCACTGTGCACAGG + Intergenic
922238666 1:223740429-223740451 CTGTTCCAGCCAATGGAAACTGG - Intronic
923656374 1:235920712-235920734 CAGTTCCAGTCACTGGACCTGGG - Intergenic
924708319 1:246515691-246515713 CAGCTCCAGCCAATGGAGACAGG - Intergenic
1063373872 10:5540163-5540185 TAGTCCCAGCTACTGGTGACGGG - Intergenic
1064441256 10:15355596-15355618 TAGTCCCAGCTACTTGAGACTGG + Intronic
1064645970 10:17460013-17460035 CAGTCCCAGCTACTTGGCAAGGG + Intergenic
1066308071 10:34166660-34166682 CAGTCCCAGCCAGGGTACATGGG - Intronic
1066583050 10:36901406-36901428 TAGGCCCAGCCACTGGAAGCAGG - Intergenic
1067468119 10:46516417-46516439 CAAGCCCAGCCAGTGGTCACTGG + Intergenic
1068350877 10:55843482-55843504 CAGTCCCAGCTACTTTACTCAGG - Intergenic
1068519833 10:58066009-58066031 CAGTCCAAGTCCCTGGAAACAGG - Intergenic
1069450831 10:68516263-68516285 CCGTTCCAGCCAATGGAAACTGG - Intronic
1069452722 10:68530048-68530070 CTGTTCCAGCCAATGGAAACCGG - Intergenic
1069708241 10:70472681-70472703 GAGTCCCAGGCTCTGGACACTGG - Intergenic
1069719567 10:70541001-70541023 CAGCCCCAGCCACTGTCCTCGGG - Intronic
1069808020 10:71138056-71138078 CAGTCCCAGGCACTGAGCAGGGG + Intergenic
1070599074 10:77853330-77853352 TAGGCCCAGCCCCTGGAGACTGG - Intronic
1070777487 10:79118372-79118394 CAGGCCCAGCTCCTGGACATTGG - Intronic
1070919080 10:80172747-80172769 CACTCCCAGCCACTGTACAGAGG + Intronic
1071520030 10:86324553-86324575 CAGTCCCACCCAAAGGACACAGG + Intronic
1071980170 10:90997573-90997595 CAGTCCTAGCCAATGAATACAGG - Intergenic
1072424659 10:95320028-95320050 CACTCCCAGACAGTGGAGACTGG + Intronic
1072564046 10:96602761-96602783 TTGTCCCAGCCACTGGTCCCTGG + Intronic
1072636658 10:97182721-97182743 CCATCCCACCCACTGGCCACTGG + Intronic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1073122675 10:101131977-101131999 CACCCCCAGCCCCTGGCCACCGG + Exonic
1073560953 10:104496369-104496391 CAGTCACAGACACTGGATCCTGG - Intergenic
1075098505 10:119489743-119489765 CAGTCCCAGCCTCTGGGGAGAGG + Intergenic
1076039336 10:127229839-127229861 CACTCCCATCCACAGCACACAGG + Intronic
1076403146 10:130196171-130196193 CTCTCCCAACCCCTGGACACTGG - Intergenic
1076565950 10:131399410-131399432 CCGTTCCAGCCAATGGAAACCGG - Intergenic
1076630286 10:131848314-131848336 CCTGCCCAGCCACTGGTCACTGG + Intergenic
1076654615 10:132015451-132015473 CCGTTCCAGCCAATGGAAACCGG - Intergenic
1077020650 11:415821-415843 CAATACCAGCCACCGGTCACTGG - Intronic
1077149982 11:1068238-1068260 CATTCCCTGCTAATGGACACTGG - Intergenic
1077211397 11:1372385-1372407 CTGTCCCAGCCACTGCACTGAGG + Intergenic
1077475755 11:2789674-2789696 CAGGCCCAGCTCCTGGGCACTGG + Intronic
1077928586 11:6707248-6707270 CTGTCTCAGCCTCTGGATACAGG + Intergenic
1078073803 11:8138918-8138940 CCGTTCCAGCCAATGGAAACCGG + Intronic
1078187517 11:9065124-9065146 CAGTCCCAGGCACTGGACTCTGG + Intronic
1078331728 11:10427887-10427909 AAGACCCATCCCCTGGACACAGG - Intronic
1079074201 11:17373522-17373544 CAGTCTGAGCCACTGGAGCCAGG - Exonic
1079093134 11:17494539-17494561 CAGCCACAGCCACAGCACACAGG + Intronic
1079135373 11:17773475-17773497 CAGTCCCTACCGCTGGAAACGGG - Intronic
1081102028 11:39014332-39014354 CAGTCTCTGCCACTTTACACTGG - Intergenic
1081583294 11:44366954-44366976 CAGTCCCCTCCACTGCTCACCGG - Intergenic
1081704366 11:45172338-45172360 CAATCCCAACCACTGGCCTCTGG - Intronic
1083020239 11:59499468-59499490 AAGTACCAGCCACCTGACACAGG + Intergenic
1083308645 11:61773481-61773503 CAGACCCAGCCCCTGCCCACCGG - Intronic
1083487688 11:62993727-62993749 CAGGCCCAGCCAGAGGACACAGG - Intronic
1083539149 11:63499953-63499975 CCGTTCCAGCCAGTGGAAACCGG + Intergenic
1083659456 11:64245493-64245515 CTGTCCCTGCCAGTGGGCACGGG + Intronic
1084215955 11:67646992-67647014 CAGTCACAGCCACGCGACGCAGG + Exonic
1084274837 11:68045980-68046002 CAGATCCAGCCCCAGGACACTGG - Intronic
1084418527 11:69048838-69048860 CAGTCCCAGCCAATGAGAACGGG - Intergenic
1085269824 11:75263607-75263629 CAGTCCCAGCCCCTGTCCTCAGG - Intergenic
1085533039 11:77202946-77202968 CACTCTCAGCCTCTGGACACAGG + Intronic
1085904143 11:80739448-80739470 TAGGCCCAGCCACTGGAAGCAGG + Intergenic
1087237617 11:95737670-95737692 CTGTCTCTGCCACTGGACTCTGG + Intergenic
1088102833 11:106173997-106174019 CCGTTCCAGCCAGTGGAAACCGG - Intergenic
1088914400 11:114216499-114216521 CAAGCCCAGCCTTTGGACACTGG + Intronic
1089053586 11:115566280-115566302 CAGTTCCAGGCACCGGACTCAGG - Intergenic
1090372565 11:126266960-126266982 CAATCCCAACCACTAGACAATGG + Intronic
1091211302 11:133863885-133863907 CAGTCCCAGCTACTCTACTCAGG + Intergenic
1091756607 12:3056515-3056537 CAGCCCCAGCCTGTGGTCACTGG + Intergenic
1092174968 12:6397743-6397765 TAGTCCCAGCTACTGGAGAGAGG - Intergenic
1092630590 12:10372049-10372071 CCGTTCCAGCCAGTGGAAACCGG + Intergenic
1094567018 12:31608403-31608425 CAGCTCCAGCCAATGGAGACAGG + Intergenic
1096478906 12:51924933-51924955 CAGTCCCAGCCCTGGGAGACTGG - Intergenic
1096514780 12:52149776-52149798 CTGGCCCAGCCAGGGGACACAGG + Intergenic
1096807132 12:54147677-54147699 CACACCCAGCCACTGGTCCCTGG - Intergenic
1100312745 12:93412642-93412664 CCGTTCCAGCCAGTGGAAACCGG - Intronic
1100419833 12:94422211-94422233 CCGTTCCAGCCAATGGAAACTGG + Intronic
1101779917 12:107825896-107825918 CAGTCCCTGTCCCTGGACAGTGG - Intergenic
1102030213 12:109736006-109736028 CAGTCACTGCCACTGGCAACAGG - Intronic
1102243549 12:111340921-111340943 CTGTTCCAGCCAGTGGAAACCGG + Intronic
1102478806 12:113206478-113206500 CTGTTCCAGCCAATGGAAACTGG + Intronic
1102514238 12:113435622-113435644 CAGTCCCAGCCGGTGGAGACGGG + Intronic
1102742951 12:115224157-115224179 CACTCCCAGACTCTGGACTCGGG + Intergenic
1103762373 12:123260387-123260409 CCGTTCCAGCCAATGGAAACCGG + Intergenic
1103796182 12:123504683-123504705 CATTCCCAACCACTGGAAATGGG + Intronic
1107108878 13:36674502-36674524 CGGTCCCAGACACTGGGAACCGG + Intronic
1108068094 13:46599455-46599477 CATTCCCACCCACAGTACACAGG + Intronic
1109312266 13:60709873-60709895 GAGTGCCAGACAGTGGACACAGG + Intergenic
1110385905 13:74910589-74910611 CAGTCTGAGTCACTAGACACAGG - Intergenic
1110549617 13:76797860-76797882 TAGTCCCAGCTACTGGGGACAGG - Intergenic
1111586446 13:90289535-90289557 CCGTTCCAGCCAATGGAAACCGG - Intergenic
1112206659 13:97330409-97330431 CAGTCCCTGCCACTAGGCACTGG + Intronic
1112302158 13:98240141-98240163 AGGCCCCAGCCACTGGCCACAGG - Intronic
1112533730 13:100229682-100229704 CTGTTCCAGCCAATGGAAACCGG + Intronic
1112556188 13:100470732-100470754 TAGTCCCAGCCACTCTACTCGGG + Intronic
1112929507 13:104716281-104716303 CCGTTCCAGCCAGTGGAAACGGG + Intergenic
1113295199 13:108951984-108952006 TAGTCCCAGCCACTCCACTCAGG + Intronic
1113507344 13:110826341-110826363 CAGTCCCCACCATTGGACATGGG - Intergenic
1114068639 14:19089518-19089540 TAGTCCCAGCTACTGAACCCGGG + Intergenic
1114093622 14:19310496-19310518 TAGTCCCAGCTACTGAACCCGGG - Intergenic
1114682650 14:24499302-24499324 CAGACCCAGCCACGGGCCTCAGG + Intergenic
1116038296 14:39655996-39656018 CAGTGCCAGACAGTGGGCACAGG + Intergenic
1116042639 14:39703599-39703621 GAGTGCCAGACAGTGGACACAGG - Intergenic
1116326492 14:43537727-43537749 CAGTCCCTGTCCCTGGACAGTGG + Intergenic
1118743297 14:68756692-68756714 CAGTCCCTGCCCCTTGACAGAGG + Intergenic
1119135569 14:72215566-72215588 CCGTTCCAGCCAATGGAAACGGG - Intronic
1119882661 14:78113450-78113472 CAGCCCCAGCCAGTGTAGACAGG + Intergenic
1120887551 14:89463656-89463678 CAGCCTCAGCCACTGGAGCCTGG + Intronic
1121714147 14:96060735-96060757 GAGTCCCTGGCACTGGGCACGGG - Intronic
1122152832 14:99734058-99734080 CAGCTCCAGCCAGTGGACACTGG + Intergenic
1122656143 14:103260676-103260698 CAGTCCCTGCGACTGGAAAGTGG - Intergenic
1123776570 15:23586420-23586442 CTGTTCCAGCCAATGGAAACCGG + Intronic
1123832286 15:24152848-24152870 CTGTTCCAGCCAATGGAAACCGG - Intergenic
1123838058 15:24216417-24216439 CTGTTCCAGCCAATGGAAACTGG + Intergenic
1123847609 15:24318712-24318734 CTGTTCCAGCCAGTGGAAACCGG + Intergenic
1123881751 15:24683243-24683265 CTGTTCCAGCCAATGGAAACCGG + Exonic
1124638780 15:31382156-31382178 CAGTCCCAGTCTCTGTCCACAGG - Intronic
1127004831 15:54557098-54557120 CAGTCTCAGACACCAGACACCGG + Intronic
1127950007 15:63795782-63795804 CCGTTCCAGCCAGTGGAAACTGG - Intronic
1127964808 15:63915622-63915644 CAGTGCCAGCCACTGAGCAGAGG + Intronic
1128502082 15:68233673-68233695 GAGTCCCAGCCTCTGGATCCAGG - Intronic
1128629603 15:69250758-69250780 CAGTCCCAGCTACTTGGGACTGG - Intronic
1129378844 15:75153006-75153028 CAGTCCCAGCTACTATACTCAGG + Intergenic
1129898879 15:79130296-79130318 CACTCCCATCCACTGGTCATAGG - Intergenic
1129899113 15:79131941-79131963 CACTCCCATCCACTGGTCATAGG - Intergenic
1129985439 15:79916080-79916102 CAGCTCCAGCCAATGGAGACAGG - Intronic
1129986033 15:79920394-79920416 CAGCTCCAGCCAATGGAGACAGG - Intronic
1130371269 15:83286456-83286478 CATTCCTAGCAACTGGAAACTGG + Intergenic
1131499674 15:92949918-92949940 CAGCTCCAGCCAATGGAGACAGG - Intronic
1132414938 15:101613088-101613110 CAGCCCCAGCCCCTGCACAGGGG - Intergenic
1132629654 16:911052-911074 GAGTCCCAGCTTCTGGAGACGGG - Exonic
1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG + Intronic
1133036934 16:3038733-3038755 CTGTCCCAGCCCCAGGACCCAGG - Intergenic
1135229690 16:20694222-20694244 CCGTTCCAGCCAGTGGAAACCGG + Intronic
1135594131 16:23728379-23728401 TAGTCCCAGCTACTGGACTTGGG - Intergenic
1136398160 16:30004247-30004269 CCCTCCCAGCCTCAGGACACTGG - Intronic
1137012583 16:35337659-35337681 CAGCTCCAGCCAATGGAGACAGG + Intergenic
1138351703 16:56349437-56349459 CAGCCCGAGGCCCTGGACACAGG + Intronic
1138509658 16:57501001-57501023 CTGTGCCAGGCACTGGGCACTGG + Intergenic
1139699456 16:68698686-68698708 CAGGCCCAGGCCCAGGACACAGG - Exonic
1140101327 16:71920043-71920065 CAGTTCCAGCCAATGGAATCAGG - Intronic
1140116816 16:72049185-72049207 CAGTTCCAGCCAATGGAATCAGG + Intronic
1140370432 16:74410267-74410289 GAGTCACAGCCAGGGGACACTGG + Intronic
1140448823 16:75053616-75053638 TAGTGACAGCCACTGGACATTGG - Intronic
1142235263 16:88919245-88919267 CCGTTCCAGCCAATGGAAACCGG + Intronic
1142318206 16:89362921-89362943 CCGTTCCAGCCAATGGAAACCGG + Intronic
1142322381 16:89392106-89392128 CCGTTCCAGCCAATGGAAACCGG + Intronic
1142346530 16:89557587-89557609 CAGGCCCAGGCACTGGGCTCCGG + Exonic
1142441306 16:90099671-90099693 CCGTTCCAGCCTCTGGAAACTGG + Intergenic
1142808902 17:2386171-2386193 CAATCCCTGCCACTGGGCTCTGG - Exonic
1143264694 17:5627551-5627573 CAGCTTCAGCCACTGGACATGGG + Intergenic
1143786752 17:9261189-9261211 CAGTCACGGCCACAGGACTCTGG + Intronic
1144389314 17:14778936-14778958 CAGTCCCAGCACCTGAACCCAGG + Intergenic
1144660149 17:17062833-17062855 CAGGCCCAGGCTCTGGACATGGG + Intronic
1144849777 17:18238246-18238268 CAGGCCAAGGCACAGGACACAGG - Intronic
1146794823 17:35773626-35773648 CAGTCCAAGCCACTGTACTGGGG - Intronic
1147377918 17:40033758-40033780 CTGTTCCAGCCACTGGATTCTGG - Intronic
1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG + Intronic
1147746624 17:42698843-42698865 CAGCCCCAGCCCCTGGCCCCCGG + Exonic
1148122843 17:45222588-45222610 CAGGCCCAGCCACCGGGCGCGGG + Intronic
1151985063 17:77537378-77537400 GAGCCCCAGCCATTGGACAGCGG + Intergenic
1151998262 17:77626683-77626705 CATTCCCAGCAGCAGGACACAGG + Intergenic
1153677754 18:7470550-7470572 CAGTCCCAGCCACTGAGCTGGGG - Intergenic
1156822987 18:41394943-41394965 CAATCCCAGCAAGTGGAAACTGG - Intergenic
1158201852 18:54949942-54949964 CTGACGTAGCCACTGGACACTGG - Intronic
1158392819 18:57057705-57057727 CTAGCACAGCCACTGGACACAGG - Intergenic
1159868394 18:73732762-73732784 CAGACCCAGCTTCAGGACACAGG + Intergenic
1160395708 18:78571221-78571243 CAGTCGCACCCACTGGAGCCTGG + Intergenic
1160569076 18:79804263-79804285 CAGCCACAGCCGCTGGACCCTGG + Intergenic
1160656676 19:275783-275805 CAATCCCAGCTACTGCAGACGGG - Intergenic
1160700686 19:505673-505695 CCGTTCCAGCCAATGGAAACCGG - Intergenic
1160988880 19:1852577-1852599 CTCTCCAAGCCCCTGGACACTGG + Exonic
1161052833 19:2173899-2173921 CAGTCAAAGCAACTCGACACTGG - Intronic
1161487390 19:4543554-4543576 CAGTGCCAGCCACGGGAACCAGG - Exonic
1162158088 19:8693540-8693562 TAGTCCCAGCCACTTGGCAAAGG - Intergenic
1162226421 19:9226370-9226392 CCGTTCCAGCCAGTGGAAACCGG - Intergenic
1162415253 19:10532209-10532231 CATTCCCAGACACTGGAGGCTGG - Intergenic
1163210690 19:15837530-15837552 CCGTTCCAGCCAATGGAAACTGG - Intergenic
1163618270 19:18342288-18342310 CAGTCCCTGCTCCTGGAAACTGG + Intronic
1164263005 19:23584973-23584995 CAGTCCCAGCTACTCTACTCAGG + Intronic
1164297057 19:23920953-23920975 CCGTTCCAGCCAGTGGAAACTGG - Intronic
1165390021 19:35533562-35533584 CTGTCGCAGCAACTGGACAACGG - Exonic
1166411616 19:42559317-42559339 CTGTTCCAGCCAGTGGAAACCGG - Intronic
1167561910 19:50231134-50231156 CAGTGCCAGCCACTGCAAACAGG - Intronic
1167660602 19:50793921-50793943 CAGCCCCAGGCGCTGGACCCGGG - Exonic
1167934223 19:52893188-52893210 CAGTGCCAGCCCCTGGAAAATGG - Intronic
1168175955 19:54628053-54628075 CTGTTCCAGCCAGTGGAAACCGG - Intronic
1168267988 19:55232599-55232621 CAGGCCCACCCTCTGGACAGAGG + Intronic
1168611556 19:57804722-57804744 CCATCCCAGCCAGTGGAAACCGG - Intronic
1202709956 1_KI270714v1_random:13345-13367 CAGTCCCAGCCTTGTGACACTGG - Intergenic
925229422 2:2219738-2219760 CTGTTCCAGCCAATGGAAACTGG + Intronic
925996598 2:9298598-9298620 CAGCCCCATGCCCTGGACACTGG + Intronic
926542300 2:14196547-14196569 CAATCCCAACCCCTGGACACTGG + Intergenic
927319067 2:21721412-21721434 CTGTCCTATACACTGGACACTGG + Intergenic
927704927 2:25291072-25291094 CACTGCCAGCCACAGGACAGAGG + Intronic
930032883 2:47069189-47069211 AAGGCCCAGCCACTGGCCAGAGG + Intronic
932197335 2:69796045-69796067 CAGTCTGAGCCACTGGAGCCAGG + Intronic
932347378 2:71004501-71004523 CAGTGCCACACACTGCACACAGG - Intergenic
932764709 2:74462358-74462380 CAGCCCCAGCCAGTGGCCAAGGG + Exonic
932886452 2:75553524-75553546 CAGTTCCAGGCTCTGGAAACAGG - Intronic
933406659 2:81868576-81868598 CCGTTCCAGCCAATGGAAACCGG + Intergenic
934112644 2:88757161-88757183 CAGTCTGACCCACTGGACCCAGG - Intergenic
934916868 2:98307315-98307337 CCGTTCCAGCCAATGGAAACCGG - Intronic
935044753 2:99470745-99470767 CTGTTCCAGCCAATGGAAACCGG + Intronic
936163851 2:110103622-110103644 CAGTCTGACCCACTGGACCCAGG - Intronic
936224852 2:110639585-110639607 CAGTCCTGGGCACTGGGCACAGG - Intronic
937927007 2:127175236-127175258 CCCTCCCAGCCTCTGGACAGGGG - Intergenic
938747635 2:134294930-134294952 CTGTTCCAGCCAATGGAAACTGG + Intronic
939651206 2:144764567-144764589 GAGTACCAGTCAGTGGACACAGG + Intergenic
940006973 2:149016871-149016893 CAGGCCCAGGCACTGGAAAATGG + Intronic
940151459 2:150607083-150607105 CCTTCCCAGCCACTGGGCATCGG - Intergenic
942560236 2:177212243-177212265 CAGTCACAGACACTGGTCCCCGG + Intergenic
943633446 2:190279915-190279937 CCGTTCCAGCCAATGGAAACCGG + Intronic
944350230 2:198717856-198717878 CACTCTCAGCCACTATACACCGG - Intergenic
946883453 2:224199245-224199267 CCGTTCCAGCCAATGGAAACCGG + Intergenic
947452269 2:230219899-230219921 CTGTCCCAGCCCCTGGAAAGGGG - Exonic
947513946 2:230784891-230784913 CTATCCCAGCCAATGGAAACTGG - Intronic
947642285 2:231713829-231713851 CAGTCCTAGACACTGGAAACGGG + Intergenic
948347168 2:237308334-237308356 CATGACCAGTCACTGGACACAGG + Intergenic
948852755 2:240716449-240716471 CAGTCCCAGAGTCTGCACACTGG + Exonic
1168900986 20:1364768-1364790 CCGTTCCAGCCAATGGAAACTGG + Intronic
1168913461 20:1467957-1467979 CAGCCCCAGCCAATGGGAACAGG + Intronic
1170537166 20:17351836-17351858 AAGTCCCAGCCACAGGAATCAGG + Intronic
1172016800 20:31880346-31880368 CAGTGCCGGCCAAGGGACACAGG + Intronic
1172687810 20:36770184-36770206 TAGTCCCAGCTACTGGAGAGAGG - Intronic
1172883856 20:38218482-38218504 CAGTCCAAGCCAGTGGTCACAGG - Intronic
1172973179 20:38888273-38888295 CAGGCCCAGGCACTGCAGACAGG - Intronic
1173546931 20:43904824-43904846 GAATTCCAGTCACTGGACACAGG + Intergenic
1173599160 20:44280499-44280521 CAGACCCAGCAACTTGAGACAGG - Intronic
1174404565 20:50294924-50294946 CAGTCCCTGCCCCTGGACTGTGG - Intergenic
1174413200 20:50349355-50349377 CAGGCCCAGCCCCTCTACACTGG + Intergenic
1175000368 20:55621684-55621706 CAGCTCCAGCCAATGGAGACAGG - Intergenic
1175800636 20:61799485-61799507 CAGGCCCAGGCTCTGGGCACAGG - Intronic
1175877263 20:62236356-62236378 TAGTCCCAGCAACTGGCCCCGGG + Intronic
1175910400 20:62402623-62402645 CAGCCCCATCCCCTGGACCCTGG + Intronic
1176360173 21:5988589-5988611 CAGGCCCAGCCACTGGACAGAGG - Intergenic
1177320171 21:19510829-19510851 TAATCCCAGCTACTGAACACAGG + Intergenic
1177604257 21:23358333-23358355 CCGTTCCAGCCAATGGAAACTGG - Intergenic
1178437957 21:32575975-32575997 CAGTCACGGCCCCTGGAGACCGG + Intergenic
1178439107 21:32584226-32584248 CAGCCCCAGCTCCTGGGCACGGG + Exonic
1178862587 21:36301666-36301688 CCGTTCCAGCCAATGGAAACCGG - Intergenic
1178918979 21:36726080-36726102 CAGGGTCAGCCACTGGCCACTGG - Intronic
1179539342 21:42074030-42074052 CAGCCCTAGCCAGTGCACACAGG - Intronic
1179763345 21:43549961-43549983 CAGGCCCAGCCACTGGACAGAGG + Intronic
1179768751 21:43596836-43596858 CGGTGCCAGCCACTGCACTCTGG + Intronic
1179903283 21:44406104-44406126 CAGTCCGAGCCACTGGCAAGGGG - Intronic
1180487110 22:15812079-15812101 TAGTCCCAGCTACTGAACCCGGG + Intergenic
1180659648 22:17454996-17455018 CTGTTCCAGCCAATGGAAACCGG - Intronic
1181306464 22:21919964-21919986 CAGTCCCAGCCTCAGAACCCAGG - Exonic
1181381765 22:22510133-22510155 CTGTTCCAGCCAATGGAAACCGG - Intergenic
1181519611 22:23437485-23437507 AAGGCCCAGCCACTGACCACGGG - Intergenic
1181646382 22:24233497-24233519 CAGGCTCTGCCACTGGGCACAGG - Exonic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1182348567 22:29684856-29684878 CAGTCCCGGTCACTGACCACAGG - Intronic
1182982227 22:34683258-34683280 GAGTCCCAGGCAGTGGGCACAGG - Intergenic
1183067021 22:35370330-35370352 CAAGCTCAGCCACTGGAAACGGG + Intergenic
1183305324 22:37079993-37080015 CACTCCCAGCCAGTGGGGACAGG - Intronic
1183342925 22:37291976-37291998 TAGTCCCTGCCCCTGGATACTGG - Intronic
1183836654 22:40459747-40459769 CAGTGCCAGGCACTGGGGACGGG + Intronic
1183859648 22:40660581-40660603 TAGTCCCAGCCACTAGGGACAGG + Intergenic
1184080315 22:42214710-42214732 CAGCCCCTGCCACAGGCCACTGG - Exonic
1184456355 22:44612195-44612217 CAGCTCCAGCCAATGGAGACAGG - Intergenic
949384535 3:3485695-3485717 CAGTCTAGGCCACTGGAGACAGG - Intergenic
950542153 3:13619052-13619074 CAGACCCACCCCCTGGACCCTGG - Intronic
950626647 3:14252375-14252397 CAGACCTGGGCACTGGACACTGG + Intergenic
952083388 3:29788077-29788099 CAGGAGCAGCCTCTGGACACAGG - Intronic
952392908 3:32895890-32895912 CACTCCCACCCACTGCCCACTGG - Exonic
953910225 3:46889054-46889076 CAGTCCCAGCCAGCTGGCACGGG + Intronic
955222922 3:57037921-57037943 CAGTCCCTGCCCCTAGCCACAGG - Intronic
957251445 3:77776037-77776059 CTGTTCCAGCCAATGGAAACCGG - Intergenic
957386499 3:79502571-79502593 CAGTCCCATCCACTGCCCAAGGG + Intronic
958654795 3:96986741-96986763 CATTCCCATACCCTGGACACTGG - Intronic
959027106 3:101252436-101252458 CACTCCCTGCCACTGGACCCTGG + Intronic
962364151 3:134766434-134766456 CTGTCCCAGGCACTGGGCAAGGG - Intronic
963959122 3:151288170-151288192 TGGTCCCAGCCACTGAACATAGG - Intronic
966335152 3:178860069-178860091 GAGTGCCAGACACTGGGCACAGG + Intergenic
966869542 3:184281275-184281297 TAGTCCCAACAACTGGAAACAGG - Intronic
967625931 3:191683670-191683692 CAGTCCCAGACACTTGTCAGAGG - Intergenic
968361563 3:198150647-198150669 CCGTTCCAGCCACTGGAAACTGG + Intergenic
968510187 4:992156-992178 ATGTCACAGTCACTGGACACAGG + Intronic
969058428 4:4416260-4416282 CAGTGGCAGCCCCTGAACACTGG + Intronic
969084266 4:4643889-4643911 CGGTTCCAGCCAATGGAAACTGG - Intergenic
969241501 4:5901674-5901696 CAGTCCATCCCACTGCACACAGG - Intronic
969264998 4:6058607-6058629 CAGTTCCAGCCAATGGAGACAGG + Intronic
969601000 4:8176356-8176378 GTGTCTCTGCCACTGGACACAGG - Intergenic
973238177 4:47928674-47928696 CAGCATAAGCCACTGGACACTGG + Intronic
978369085 4:108012502-108012524 CCGTCCCAGCCAATAGAAACCGG - Intronic
978716631 4:111851612-111851634 TAATACCAGCCACTGGACTCTGG - Intergenic
982001608 4:151025917-151025939 TAGTCCCAGCTACTGGGTACTGG + Intergenic
982026709 4:151258839-151258861 CACTCCCTGCCCCTGGACTCAGG - Intronic
983843124 4:172481896-172481918 CAGTCCCATCCACTGCCCAAGGG - Intronic
985994135 5:3587279-3587301 CACTCCCAGCCAAGGCACACAGG + Intergenic
986135630 5:4974999-4975021 GAGTCCCAGCACCTGGGCACAGG + Intergenic
990907600 5:60820491-60820513 CTATCCCAGACACTGGTCACAGG - Intronic
991090721 5:62691272-62691294 CTGTTCCAGCCAATGGAAACCGG - Intergenic
991362379 5:65833945-65833967 TAGTCCCAGCCACTTGAGCCTGG + Intronic
992348212 5:75902099-75902121 GAGTGCCAGACACTGGGCACAGG - Intergenic
993202516 5:84834416-84834438 CCGTTCCAGCCAGTGGAAACCGG + Intergenic
993259258 5:85638570-85638592 GAGTGCCAGCCAGTGGGCACAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995416053 5:111914546-111914568 CCGTTCCAGCCAGTGGAAACCGG + Intronic
997889568 5:137663346-137663368 CAGCCCCAGCCCCAGGGCACTGG + Intronic
998859960 5:146432898-146432920 CCGTTCCAGCCAGTGGAAACCGG - Intergenic
999082381 5:148856574-148856596 CAGTACCAGCCACTGGCCTCTGG - Intergenic
999348598 5:150845777-150845799 CAGTCCCATCCACTGCCCAAGGG + Intergenic
999833850 5:155347960-155347982 CCGTTCCAGCCAATGGAAACTGG + Intergenic
1001668917 5:173457599-173457621 CAGTGCCTGCCACAGGACAAGGG - Intergenic
1001974473 5:175985852-175985874 CTGTTCCAGCCAGTGGAAACTGG - Intronic
1002242959 5:177857927-177857949 CTGTTCCAGCCAGTGGAAACTGG + Intergenic
1002451029 5:179318617-179318639 AAATGCCAGCCACTGGACAGTGG - Intronic
1003153985 6:3575754-3575776 CAGTTCCAGCCACCAGAGACAGG - Intergenic
1003475588 6:6479192-6479214 CCGTTCCAGCCAGTGGAAACCGG - Intergenic
1005954517 6:30654612-30654634 CAGTCCCAGCAACTTGAACCTGG + Intronic
1006050322 6:31337151-31337173 CAGTTCCAGCCAATGGAGACAGG - Intronic
1006412245 6:33880924-33880946 CCGTTCCAGCCAGTGGAAACCGG + Intergenic
1006653015 6:35567011-35567033 CAGCTCCAGCCAATGGAGACAGG - Intergenic
1008359556 6:50599296-50599318 CAGGCCCAGCCAGGGGGCACTGG - Intergenic
1009230316 6:61053416-61053438 CAGTGCCAGACAGTGGGCACAGG - Intergenic
1010269404 6:73903504-73903526 CAGTCCCATCCACTGCCCAAGGG + Intergenic
1011660948 6:89593339-89593361 CAGGCCCAGCCAGTGGAACCTGG + Intronic
1013080287 6:106806107-106806129 CAGTCCCATCAACTGCCCACGGG + Intergenic
1015209976 6:130685952-130685974 TAGTCCCAGCCACCAGAGACTGG - Intergenic
1015931293 6:138362636-138362658 CAGTCCCAGCTACTTGATAAAGG - Intergenic
1016370314 6:143366662-143366684 CTGTCCCAGCCATGGGACAGTGG + Intergenic
1016983744 6:149878132-149878154 CAGTCCCAGCCACAGCAGTCAGG + Intergenic
1018880193 6:167870164-167870186 CAGTGCCAGACACTGAACAGAGG - Intronic
1018971631 6:168533622-168533644 CAAGCCAAGCCACTGCACACTGG - Intronic
1019254122 7:38073-38095 CCGTTCCAGCCACTGGAAACTGG - Intergenic
1019497262 7:1346417-1346439 CAGGCCCAGCCACTGGCCCGGGG + Intergenic
1019591649 7:1838793-1838815 AAGGCCCAGCCACTGACCACGGG + Exonic
1020142517 7:5620487-5620509 CAGGCCCTGCCTCTGGACAGAGG + Intronic
1021979817 7:26043569-26043591 CAGTGCCAGCCCCTGGAGCCTGG - Intergenic
1023756235 7:43419898-43419920 CTGTGCCAGCCATTGGAAACTGG - Intronic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1024247301 7:47480002-47480024 AAGGCCCAGCCACTGGAGCCAGG + Intronic
1026446717 7:70491021-70491043 CAGTTTCATCCACTGGTCACAGG + Intronic
1026710652 7:72736145-72736167 CTGTTCCAGCCAATGGAAACTGG - Intronic
1029548186 7:101222339-101222361 CAGTCCCAGCCAGTGAGCCCCGG - Intronic
1030360021 7:108586030-108586052 CTGTCCCCTCCACTGTACACTGG + Intergenic
1030742685 7:113128502-113128524 CAGGCCCAGACACTGCACACAGG - Intergenic
1032013343 7:128360675-128360697 CAGGCCCAGCCCCAGGAAACGGG - Intronic
1033453972 7:141485842-141485864 CAGTCCCAGCCACCGGACAGGGG - Intergenic
1034380064 7:150684131-150684153 CACTCCCAGCAACTGGAGATAGG - Intergenic
1035686897 8:1530199-1530221 CAGTCTCAACCACAGGAGACAGG + Intronic
1037598359 8:20373420-20373442 CTGTCACTGCCACTGGACAGAGG - Intergenic
1038525092 8:28266215-28266237 CCGTTCCAGCCAGTGGAAACTGG - Intergenic
1038535265 8:28349060-28349082 GAGTCCACGCCACTGGAGACAGG + Intronic
1042269751 8:66942903-66942925 CAGTGCCAGAGACTGGACACTGG - Intergenic
1042860219 8:73305624-73305646 CAGTTACAGCCACTGGACCTGGG + Intronic
1043515383 8:80990556-80990578 CAGTCCCAGCCGCTGGGGAGGGG - Intronic
1044902129 8:96957960-96957982 TAGTCCCAGCTACTGGAGAGGGG - Intronic
1047292625 8:123542788-123542810 TAGTCTCAGCTACTGGAGACTGG - Intergenic
1049157746 8:141076991-141077013 CAGTCCCATCCACTGCCCAAGGG + Intergenic
1049456585 8:142694768-142694790 CAGTCACAGCCCATGGTCACAGG - Intergenic
1052466676 9:28838885-28838907 GGGACCCAGCCACTGTACACAGG + Intergenic
1053062197 9:35041022-35041044 CTGTTCCAGCCAATGGAAACCGG - Intergenic
1054931786 9:70642641-70642663 AATTCCCAGCCTCTGGACATTGG - Intronic
1055847659 9:80586801-80586823 CACTCTCAGCAACTAGACACTGG + Intergenic
1056049955 9:82757724-82757746 GAGTGCCAGCCAGTGGACGCAGG - Intergenic
1056373128 9:85979252-85979274 CTGTTCCAGCCAATGGAAACCGG - Intronic
1057205745 9:93171322-93171344 CAGTCCCAGCCACAGGGCAGTGG - Intergenic
1059200771 9:112413898-112413920 CCGTTCCAGCCAATGGAAACCGG - Intronic
1059281340 9:113136634-113136656 CAGGCCCAGGCACTGGACACAGG + Intergenic
1060978082 9:127777035-127777057 CAATCCCAGACCCTGGACTCTGG - Intronic
1061470091 9:130817532-130817554 CTGTTCCAGCCAATGGAAACTGG + Intronic
1061501475 9:131005515-131005537 CCGTTCCAGCCAATGGAAACTGG + Intergenic
1061595065 9:131623670-131623692 CAGTCCCAGGCCCTGAGCACTGG - Intronic
1061783288 9:133008184-133008206 CAGTCCCCTCCCCTGGCCACTGG - Intergenic
1061885981 9:133591334-133591356 CAGGCCCAGCCTCAGGGCACTGG + Intergenic
1062005130 9:134235129-134235151 CAGTGCCAGCCACAAGAGACTGG - Intergenic
1062016252 9:134292734-134292756 CAGTCCCAGACGCTGGCCTCAGG - Intergenic
1062214202 9:135380347-135380369 CAGTCCCAGCCCCAGTACAAAGG + Intergenic
1062698981 9:137889466-137889488 CAGCCCCAGCCCCAGAACACGGG - Intronic
1062746281 9:138214468-138214490 CCGTTCCAGCCACTGGAAACTGG + Intergenic
1185513925 X:684162-684184 CCGTTCCAGCCAATGGAAACCGG - Intergenic
1186156010 X:6727684-6727706 CAGCCACACCCACTGGCCACAGG - Intergenic
1186561968 X:10622227-10622249 ATGCCCCAGCCACAGGACACAGG + Intronic
1187271830 X:17787249-17787271 GAGTGCCAGACAGTGGACACAGG - Intergenic
1188157472 X:26757210-26757232 CCGTTCCAGCCAATGGAAACTGG + Intergenic
1188688417 X:33098810-33098832 CTGTTCCAGCCAATGGAAACCGG - Intronic
1189416929 X:40823507-40823529 CCGTTCCAGCCAATGGAAACCGG + Intergenic
1189516705 X:41719685-41719707 CCGTTCCAGCCAATGGAAACCGG - Intronic
1189620660 X:42833920-42833942 CCGTTCCAGCCAATGGAAACCGG + Intergenic
1189784302 X:44545546-44545568 CCGTTCCAGCCAGTGGAAACCGG - Intergenic
1189823290 X:44891741-44891763 CCGTTCCAGCCAATGGAAACTGG - Intronic
1189888723 X:45577064-45577086 CAGTCCCATCCTCAGGACCCTGG + Intergenic
1190740225 X:53283702-53283724 CTGACCCAGCCACGGGACACTGG + Intronic
1191881282 X:65845806-65845828 CAGGCCCATCCACTGACCACAGG - Intergenic
1192294089 X:69828586-69828608 GAGTGCCAGACACTGGGCACAGG - Intronic
1192573970 X:72228126-72228148 CCGTTCCAGCCAATGGAAACTGG + Intronic
1194991309 X:100550383-100550405 GAGTGCCAGCCAGTGGGCACGGG + Intergenic
1199151709 X:144494690-144494712 CCGTTCCAGCCAATGGAAACTGG - Intergenic
1199221909 X:145326405-145326427 CCGTTCCAGCCAATGGAAACTGG - Intergenic
1199637718 X:149829409-149829431 CCGTTCCAGCCAATGGAAACCGG + Intergenic
1200250794 X:154552757-154552779 CAGTCCCAGCCACTGGGTGTGGG - Intronic
1201549386 Y:15203950-15203972 CAGTCACACCCACTGGCCACAGG - Intergenic
1201668954 Y:16493472-16493494 CCGTTCCAGCCAATGGAAACTGG + Intergenic
1202083016 Y:21104462-21104484 AAGTCCCAGCCACTGCCCCCAGG + Intergenic