ID: 1132889032

View in Genome Browser
Species Human (GRCh38)
Location 16:2195359-2195381
Sequence CTGTGGGGGTGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2513
Summary {0: 1, 1: 1, 2: 28, 3: 265, 4: 2218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132889021_1132889032 14 Left 1132889021 16:2195322-2195344 CCTGGAGGAAGGGGAGGGGGACT 0: 1
1: 1
2: 2
3: 82
4: 753
Right 1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG 0: 1
1: 1
2: 28
3: 265
4: 2218
1132889019_1132889032 16 Left 1132889019 16:2195320-2195342 CCCCTGGAGGAAGGGGAGGGGGA 0: 1
1: 1
2: 13
3: 101
4: 784
Right 1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG 0: 1
1: 1
2: 28
3: 265
4: 2218
1132889020_1132889032 15 Left 1132889020 16:2195321-2195343 CCCTGGAGGAAGGGGAGGGGGAC 0: 1
1: 0
2: 4
3: 89
4: 713
Right 1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG 0: 1
1: 1
2: 28
3: 265
4: 2218
1132889017_1132889032 17 Left 1132889017 16:2195319-2195341 CCCCCTGGAGGAAGGGGAGGGGG 0: 1
1: 0
2: 11
3: 90
4: 777
Right 1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG 0: 1
1: 1
2: 28
3: 265
4: 2218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132889032 Original CRISPR CTGTGGGGGTGGAGGGAGGA GGG Intronic
Too many off-targets to display for this crispr