ID: 1132893179

View in Genome Browser
Species Human (GRCh38)
Location 16:2214507-2214529
Sequence CCGCGGGGCCGCCGAAGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132893167_1132893179 5 Left 1132893167 16:2214479-2214501 CCGAAGACCTCCAGGCTGGCGCC 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG 0: 1
1: 0
2: 5
3: 29
4: 214
1132893165_1132893179 10 Left 1132893165 16:2214474-2214496 CCGTGCCGAAGACCTCCAGGCTG 0: 1
1: 0
2: 3
3: 14
4: 143
Right 1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG 0: 1
1: 0
2: 5
3: 29
4: 214
1132893171_1132893179 -5 Left 1132893171 16:2214489-2214511 CCAGGCTGGCGCCGGGCCCCGCG 0: 1
1: 0
2: 1
3: 41
4: 398
Right 1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG 0: 1
1: 0
2: 5
3: 29
4: 214
1132893170_1132893179 -2 Left 1132893170 16:2214486-2214508 CCTCCAGGCTGGCGCCGGGCCCC 0: 1
1: 0
2: 5
3: 40
4: 366
Right 1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG 0: 1
1: 0
2: 5
3: 29
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132893179 Original CRISPR CCGCGGGGCCGCCGAAGCCC AGG Exonic
900237509 1:1599838-1599860 GCGCGGGGCTGCGGAAGCACAGG + Exonic
900241915 1:1621265-1621287 CCGCGGGGCCTCCGAGGGCAAGG + Intronic
900245188 1:1633234-1633256 CCGTGGGGCCGTCGAAGCAGTGG - Exonic
900256419 1:1700393-1700415 CCGTGGGGCCGTCGAAGCAGTGG - Intronic
900393556 1:2444026-2444048 GCGCGGGGGCGCCGCAGCCCTGG + Intronic
900513373 1:3070439-3070461 CCGCAGCCCCGCCGAAGCCCCGG + Intronic
901034771 1:6329854-6329876 CAGAGGGGCAGCCGCAGCCCTGG - Intronic
901109836 1:6785644-6785666 GCCCGGCGCCGCCGATGCCCGGG - Intronic
901762280 1:11479032-11479054 CCGCGCTGCCGCCCAATCCCTGG - Intergenic
902089643 1:13893097-13893119 GCGCGGGGACGCGGGAGCCCAGG + Intergenic
903282535 1:22258099-22258121 CCACGGGGCAGCCGCAGGCCAGG + Intergenic
903522226 1:23959564-23959586 CCCCTGGCCCGCCGAGGCCCCGG - Intronic
904252693 1:29236444-29236466 CCGCGAGACCGCCGAACCCGCGG + Intergenic
905037828 1:34929348-34929370 CCCCGGCGCCGCCCACGCCCCGG - Intronic
906293021 1:44632093-44632115 GCGCGGTGCCGCCCCAGCCCTGG - Intronic
906678491 1:47709647-47709669 CCGCGGGGCCGCCCCTCCCCCGG + Intergenic
907069337 1:51519425-51519447 CCGCGGCGCCGCCCAAACCCTGG + Intergenic
907136266 1:52142192-52142214 CCGCGTGGCTGCCGCGGCCCGGG + Exonic
907179138 1:52553810-52553832 CCGAGGGTCCGCCGAGGCTCGGG - Intergenic
912315100 1:108661150-108661172 CCGCGGGGAGGCCGAGGCGCGGG - Intronic
915524174 1:156466100-156466122 CCCAGGGGCAGCCGAAGCACGGG - Exonic
915530759 1:156500901-156500923 CCTCGGGACCGCCCCAGCCCCGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
920559679 1:206930338-206930360 CACCGTGGCCGCCGAGGCCCAGG - Exonic
923171748 1:231422534-231422556 CCTCGGGGACGCCGAGGCGCAGG + Exonic
924947687 1:248857395-248857417 CCGCCAGGCCCCCGAAGCCCGGG + Exonic
1065589596 10:27251613-27251635 CCCGGGGGCCGCCTGAGCCCTGG - Intergenic
1072629495 10:97135582-97135604 CCGCTGGGCCGCCTGAGGCCTGG + Intronic
1073543801 10:104332937-104332959 CCACGAGGCCGCTGAATCCCTGG + Intronic
1075786407 10:125053146-125053168 CCACGGGGCCACCGAAGCCAAGG + Intronic
1077168902 11:1157743-1157765 CCGAGGGCCCCCCCAAGCCCTGG - Intergenic
1077185475 11:1233713-1233735 CGGCGGGGGCTCGGAAGCCCGGG + Intronic
1078091675 11:8268199-8268221 TCCCGCCGCCGCCGAAGCCCGGG + Intronic
1078371626 11:10751276-10751298 CCGCGGCGCCGCTGGAGCTCTGG - Exonic
1078474647 11:11620601-11620623 CCGCGGGGAAGGCGCAGCCCAGG + Intronic
1084177072 11:67428527-67428549 CCGCGGGGCCGGCGCCGCCATGG + Exonic
1084522886 11:69675265-69675287 CCGCGGGGCTGCAGAAACCCGGG - Exonic
1091473819 12:753067-753089 CCCCGGGGCCGCCACCGCCCGGG + Exonic
1091581592 12:1793729-1793751 CCGAGGCGCCGCCGCAGTCCTGG + Exonic
1091732349 12:2890611-2890633 CCGCGCGGCGGGCGAGGCCCAGG + Intronic
1094624170 12:32107009-32107031 ACCCGCGGCCGCCGCAGCCCGGG + Intronic
1095271440 12:40224553-40224575 CCGTGGGGCCGCAGGATCCCCGG + Intronic
1095672369 12:44876245-44876267 GTGCGGGGCCGCCCCAGCCCGGG - Intronic
1096627252 12:52903563-52903585 CCTCGGGGCCGCCGGGGGCCCGG + Intronic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1102101519 12:110281771-110281793 CGGCCGGGCCCCCGAAGCCATGG + Exonic
1102218928 12:111181120-111181142 CCGCGGGGCCGCCGCGTGCCAGG + Intronic
1103339765 12:120215214-120215236 CTGGGGGGCCCCCGAAGCCCGGG - Exonic
1103563346 12:121803874-121803896 CAGCTGCGCCGCCAAAGCCCCGG - Intergenic
1105409741 13:20161440-20161462 TCGCCGGGCCTGCGAAGCCCAGG - Intergenic
1107548853 13:41457360-41457382 ACGAGGAGTCGCCGAAGCCCCGG - Intergenic
1108313934 13:49220308-49220330 CCGCGCGGCCGCCGCGTCCCGGG - Intergenic
1113723463 13:112579373-112579395 CCGCGGGGCCACGGCATCCCTGG + Intronic
1113723485 13:112579465-112579487 CCGCGGGGCCACGGCATCCCCGG + Intronic
1114474085 14:22981976-22981998 CCGCGGGGCCGCCGCCCACCCGG - Exonic
1114553926 14:23550895-23550917 GCGGGGGGCCGCCGAGACCCAGG + Intronic
1115271870 14:31561595-31561617 CTGCAGGGCCGCAGATGCCCTGG + Intronic
1121127559 14:91417841-91417863 GCGCGGGGCCGCCGAAGCCGCGG - Intronic
1121334603 14:93069619-93069641 CCGTGGGGATGCCCAAGCCCAGG - Intronic
1122124791 14:99573149-99573171 CCGCGGGGACTCCGAGGCACCGG - Intronic
1122486590 14:102086575-102086597 CCGGGAGGCCGCCGCAGGCCCGG + Intronic
1123036668 14:105474563-105474585 CCGCGGCGCCGCCCGCGCCCCGG - Intronic
1123964124 15:25438656-25438678 CGCCGGGGCCGCCGAAATCCCGG + Exonic
1124427010 15:29570844-29570866 GCGCGCGGCCGCCGCAGCCCTGG - Intergenic
1125718761 15:41835201-41835223 GCCCTGGGCCTCCGAAGCCCTGG + Exonic
1126668414 15:51094677-51094699 CAGCGGGGCGGCTGGAGCCCGGG + Exonic
1129016640 15:72474571-72474593 GGGCGGGGACGCCGAGGCCCCGG - Exonic
1129330274 15:74823571-74823593 CCGCATGGCTGCAGAAGCCCAGG + Exonic
1129440769 15:75579365-75579387 CCGCGGGGCGGCCGCAGCGTTGG - Intergenic
1130371119 15:83285551-83285573 CCCCGGGGCAGCAGAAACCCGGG - Intergenic
1131517548 15:93089148-93089170 CCGCTGGGCCGGGGAAGCACTGG - Intronic
1132839616 16:1972623-1972645 GGGCGGGTCCGCAGAAGCCCAGG + Intronic
1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG + Exonic
1133188265 16:4115712-4115734 CCGCGTGGCCGCCGTGGCTCCGG + Exonic
1134362385 16:13543653-13543675 CACCAGGGCCGCAGAAGCCCAGG + Intergenic
1136498815 16:30659615-30659637 CAGCGGCGCCGCCGAGGTCCAGG + Exonic
1137268075 16:46884790-46884812 CAGCGCGGCCGCCGAGGCCTCGG + Exonic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1141640709 16:85339385-85339407 CCGCGGTGCTGACGAGGCCCTGG + Intergenic
1141736836 16:85859726-85859748 CCGCGGGGCCGCTGGAGGCTAGG + Intergenic
1142150093 16:88508878-88508900 CCGCGGGGCCCCTGAGGACCTGG - Intronic
1142395354 16:89828588-89828610 GCGCAGGGCGGCCGGAGCCCTGG + Exonic
1143183434 17:4997689-4997711 CCGCGGGGGCACCCAGGCCCCGG - Intergenic
1143240402 17:5438886-5438908 CCGCGAGGCCGCAGGAGGCCCGG + Exonic
1143568659 17:7740686-7740708 TCCCGGGGACGCCGAAGCCAGGG - Intronic
1143719401 17:8799244-8799266 CCGCGGCGCCGCCCCAGACCGGG - Exonic
1145041296 17:19579938-19579960 CCCTGCGGCCGCCGACGCCCCGG + Intergenic
1148361681 17:47017350-47017372 CCCTGGGGCCGCCTGAGCCCTGG + Intronic
1150405462 17:64897078-64897100 CCCTGGGGCCGCCTGAGCCCTGG - Exonic
1151655481 17:75493957-75493979 CCCCTGGGCTGCCGAAGCCCAGG + Intronic
1152205625 17:78973079-78973101 CCGTGTGGCCACAGAAGCCCAGG + Exonic
1152467912 17:80476137-80476159 CCCCGGAGCCGGCGAGGCCCGGG - Exonic
1152657913 17:81528449-81528471 CCGCGGTCCCCCAGAAGCCCGGG - Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1153794456 18:8609645-8609667 CCGAGGGGGCGCCGGGGCCCGGG + Exonic
1154241513 18:12657786-12657808 GCGAGGGGCCGCGGGAGCCCGGG - Exonic
1156008361 18:32470157-32470179 CCGAGCGGCTGCCGCAGCCCTGG - Intronic
1156350561 18:36298071-36298093 CCAGGGGGCCCACGAAGCCCCGG - Intronic
1159798045 18:72867622-72867644 CCGCGGCGGCGACGATGCCCGGG - Exonic
1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG + Exonic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1161556267 19:4944465-4944487 CCGCGTGGCCCCTGGAGCCCCGG - Intronic
1163118071 19:15200167-15200189 CCGCGGGGACCCGGAGGCCCTGG - Intronic
1163138667 19:15332001-15332023 CCGCCGGCCAGCCCAAGCCCGGG + Intronic
1163607185 19:18281750-18281772 CCGCCCGGCCGCCGTTGCCCCGG + Intergenic
1163725180 19:18919306-18919328 CCCCGGAGCCGCCGGAGGCCGGG + Exonic
1164149017 19:22532712-22532734 CGGCGGGGCCGCCGGATCCAGGG + Intergenic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165419866 19:35717529-35717551 CCCCGGGACCCCCGAGGCCCTGG - Intergenic
1165939827 19:39409609-39409631 GCGCGGCGCCCCCGACGCCCGGG - Intergenic
1166736694 19:45090142-45090164 CCCCGGGGCAGCCGGAGCACAGG - Exonic
1168108851 19:54180813-54180835 CCCCGTGGCCGCCAAAGCCCGGG - Exonic
1202683211 1_KI270712v1_random:29111-29133 CGGCGGGGGCGCAGAAGCCGCGG - Intergenic
927713941 2:25341187-25341209 CCGCGGGGCCGAGGAGGGCCGGG + Intronic
929242407 2:39666112-39666134 CCGCGCGGGCGCCGACCCCCCGG + Exonic
929701900 2:44169316-44169338 CGGCCGCGCCGCCGAGGCCCCGG + Intronic
932332809 2:70907605-70907627 CCGCGGAGCTGCGGAAGCCAGGG + Intronic
933847547 2:86337710-86337732 CTGCGGGCCCGCCGAGCCCCGGG - Intronic
934993333 2:98936370-98936392 CCGCGGGGCGTCCAAGGCCCAGG - Intergenic
935125344 2:100217748-100217770 CAGCAGGGCTGCTGAAGCCCTGG - Intergenic
938368820 2:130756214-130756236 CCGCGGGGCCCCTGGAGCCGCGG + Intronic
938460512 2:131493233-131493255 CCGCCGGGCCGCCCGAGTCCTGG - Intergenic
940265125 2:151828319-151828341 CCGGAGGGAGGCCGAAGCCCAGG + Exonic
940293371 2:152098820-152098842 GAGCGGGGCCGCCGACTCCCGGG + Intronic
942151037 2:173076088-173076110 CCGAGGCTCCGCCGGAGCCCGGG + Intronic
946327791 2:218993621-218993643 CCCCGCGCCCGCCGCAGCCCAGG + Intergenic
947418478 2:229921693-229921715 CGGCGGGGCCGCGGAAGGACCGG - Intronic
947641627 2:231710432-231710454 CCCCCTGGCGGCCGAAGCCCCGG - Intronic
947722629 2:232378999-232379021 CCGCGAGGCAGCCGAGGCCCTGG + Exonic
947726971 2:232407085-232407107 CCGCCAGGCAGCCGAGGCCCTGG + Exonic
947992171 2:234496706-234496728 CCGCGGGGACGCCGAGCCCCGGG - Exonic
948430314 2:237914312-237914334 CCGCGGGGCTGCTGAAGCCAGGG - Intergenic
1171823213 20:29874264-29874286 CCGCGCCCCAGCCGAAGCCCAGG + Intergenic
1171896882 20:30816048-30816070 CCGCGCCCCAGCCGAAGCCCAGG - Intergenic
1172073654 20:32277690-32277712 CGGCGGGGGCGGCGAACCCCTGG - Exonic
1173843581 20:46174514-46174536 CCGCGGGGACGACGAGGCCCAGG - Exonic
1173952929 20:47007490-47007512 GGGCGGGGCCTCCGAGGCCCAGG + Intronic
1174246799 20:49188014-49188036 GCGCGGGCCCGCCGAGGCCTAGG + Intronic
1174287409 20:49482910-49482932 CGCCTGGGCCGCAGAAGCCCAGG - Intergenic
1174399336 20:50267584-50267606 CCGCGGGGAGGCCCAAGCCCCGG + Intergenic
1175847026 20:62064841-62064863 CCGCGGGGCCCCCGGCGGCCGGG + Exonic
1175985087 20:62760639-62760661 CAGCCGGGCCGCCGGAGGCCCGG - Exonic
1176239385 20:64068895-64068917 AGGCGGGGCCGCCCAAGGCCAGG - Intronic
1176299969 21:5094901-5094923 CCGCCTGGCCCCTGAAGCCCTGG + Intergenic
1179857053 21:44167010-44167032 CCGCCTGGCCCCTGAAGCCCTGG - Intergenic
1180078003 21:45472954-45472976 CGGCTGGGCCCCCAAAGCCCAGG - Intronic
1180086794 21:45511154-45511176 CTGAGGGTCCGCTGAAGCCCGGG + Exonic
1180096388 21:45557182-45557204 CCCTGGGGCTGCTGAAGCCCTGG + Intergenic
1180180846 21:46118117-46118139 CGGCGGGGCCGCCCAAGCCCTGG - Intronic
1180184477 21:46132687-46132709 CCACGGGGTCCCCGTAGCCCCGG + Exonic
1181710706 22:24685985-24686007 CCGGCGGGAGGCCGAAGCCCAGG - Intergenic
1183425029 22:37734734-37734756 CCTGGGGGCAGCCAAAGCCCCGG + Exonic
1184034116 22:41910508-41910530 CCCCGGGGCGGCCGACCCCCGGG + Exonic
1184043419 22:41957865-41957887 CCTCCGGGCCGCCGAAGGCCAGG - Intergenic
1184680601 22:46070729-46070751 CCGCGGGGCCGGCGGTGTCCTGG + Intronic
1184698010 22:46150524-46150546 CCGCGGGGCCGCCGCGTCCACGG - Intronic
1185153407 22:49179355-49179377 CCACGGGGCCGCCGAGGGCCTGG - Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
950888319 3:16380357-16380379 CTGCAGGGCCGCAGAAGCCCAGG - Intronic
952644651 3:35640123-35640145 CCGAGCCGCCGCCGCAGCCCTGG + Intronic
954421224 3:50420017-50420039 CCGCGGAGACGCGGAAGGCCTGG + Intronic
958779303 3:98522616-98522638 CGGCGGGGCCGGAGAAGGCCAGG + Intronic
958932745 3:100225252-100225274 CCGCCGTGCCACCGCAGCCCAGG - Intergenic
961389202 3:126542417-126542439 CCCCGGGGCCGCGGCGGCCCAGG - Exonic
963061953 3:141232536-141232558 CCACGGGGCCGCCCGAGCGCAGG + Intronic
963827433 3:149970647-149970669 CCGCGGGGGCACCGCAGCGCGGG - Intronic
965590742 3:170358044-170358066 CCGCGGGGACCCCGGAGACCCGG + Intronic
966594300 3:181712285-181712307 CCGCGGGCCCCCCAAAGTCCCGG + Exonic
968051625 3:195658446-195658468 CCGCGAGGTCGCCGGACCCCAGG - Intergenic
968104191 3:195989887-195989909 CCGCGAGGTCGCCGGACCCCAGG + Intergenic
968302492 3:197627477-197627499 CCGCGAGGTCGCCGGACCCCAGG + Intergenic
968433990 4:575786-575808 CCGCGGGGACCCCCAAACCCGGG + Intergenic
968593736 4:1472213-1472235 CCGCGGGGCAGCCGGAGCCCGGG + Intergenic
969429423 4:7145461-7145483 CCCCGGGGCTGCAGAAGCCTGGG - Intergenic
971195809 4:24471193-24471215 CCGCGGGGCCCGGGAATCCCCGG + Intergenic
971351841 4:25862704-25862726 CAGAGCGGCCGCCGAGGCCCTGG + Exonic
972298972 4:37767293-37767315 CTGCGGTGCTGCCGAAGCCCAGG + Intergenic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
974549096 4:63349137-63349159 CCGCGGGGCCGTGGACGCCGAGG - Intergenic
975166871 4:71187225-71187247 CTGGGGGGCCGCGGAATCCCTGG - Intergenic
975983545 4:80184065-80184087 CCGCGGGGCAGGCGAAGGGCGGG + Intronic
981044543 4:140253110-140253132 CTCCTGGGTCGCCGAAGCCCCGG + Intergenic
982198387 4:152937284-152937306 GCGCGCGGCCGCCGCAGACCCGG + Intronic
982288794 4:153759937-153759959 CCGCGGGGCCTCGGGAGCCGAGG + Exonic
983649843 4:170026682-170026704 CCGCGCTGCCGCGGAGGCCCTGG - Intronic
985164029 4:187073982-187074004 CTGCGGGGCTGTTGAAGCCCTGG + Intergenic
993900934 5:93584153-93584175 CCGCGGCGCCGCCGCTGTCCCGG - Exonic
996978237 5:129460201-129460223 CCGGGAGGCCGCCGAAGCCCTGG - Intergenic
997817490 5:137033153-137033175 CCTCGTGGCGGCCGAAGGCCTGG + Intronic
999253959 5:150199255-150199277 CCCCAGGGCTGCCGATGCCCTGG - Exonic
1001110898 5:168895324-168895346 CCTCTGGGCAGCCGCAGCCCAGG - Intronic
1002091670 5:176810150-176810172 CGCCGGGGTCGCCGCAGCCCCGG + Intergenic
1003139303 6:3457224-3457246 ACGCGCGGCCGCCGCCGCCCGGG + Intergenic
1003870444 6:10398560-10398582 CCGCGGGGCTGCCGAAGCCGTGG + Exonic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1004208640 6:13615484-13615506 CGGCGCGGCCGCCGAGCCCCTGG + Exonic
1005895180 6:30171938-30171960 CCGGGAGGCCGTCGAAGCGCAGG - Exonic
1007072835 6:39049175-39049197 CCGCGGGGCAGCGGGTGCCCGGG - Intronic
1011449047 6:87473306-87473328 CTCCGGGTCCGCCGCAGCCCCGG - Intronic
1019111890 6:169723890-169723912 CCGCGGGGACAGCGCAGCCCCGG + Exonic
1019293320 7:260993-261015 CCTCGGGGCCGCCGCAGCTTTGG - Intergenic
1019379182 7:712356-712378 CCGGGGGGCCTCCCAGGCCCGGG + Intronic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1020281945 7:6654407-6654429 CCGCGGAGCCACCGCAGCGCCGG + Exonic
1021452775 7:20798055-20798077 GCCCGCGGCCGCCGCAGCCCGGG - Intergenic
1021828042 7:24573721-24573743 CCCCGCGCCCGCCGAAGCCCAGG - Intronic
1022360202 7:29649943-29649965 GCGCGGGGCCTCCCAAGCCCAGG + Intergenic
1022360345 7:29650756-29650778 GCGCGGGGCCTCCCAAGCCTGGG + Intergenic
1025917052 7:65873738-65873760 CCGGGGGGCGGCCTGAGCCCAGG + Intronic
1027111397 7:75442623-75442645 CGGCCGGCCCGCCGCAGCCCCGG + Intronic
1028621477 7:92833511-92833533 CCGCGGGGCTGGCGTAACCCTGG + Exonic
1029286405 7:99468812-99468834 ACGCAGAGCCGCCGGAGCCCAGG + Intergenic
1029372585 7:100158734-100158756 GGGCGTGGCCGCCGAGGCCCCGG + Intergenic
1029480959 7:100812713-100812735 CCGGGTGGCCGCAGAAGCCAGGG + Intronic
1030093382 7:105876857-105876879 CAGCGGCGCCGCCCAAGCCTGGG + Intronic
1031483180 7:122302018-122302040 CCCCGGGGCCCCTGCAGCCCGGG - Exonic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1032011643 7:128351452-128351474 CCGCCGCGCCTTCGAAGCCCCGG + Exonic
1034201428 7:149285326-149285348 TCGCGGGGCCGCCGGGGCTCGGG - Intronic
1034254030 7:149714802-149714824 CGGCCGGGCCGCCGAAGCCGGGG + Intronic
1038041419 8:23727057-23727079 ACGCGGGGCCGCCGGCGCCAGGG + Intergenic
1041658360 8:60376550-60376572 CCGTGGGGCCTCGGGAGCCCTGG + Intergenic
1049504566 8:142989095-142989117 CCTGGGGGCCGCAGCAGCCCGGG - Intergenic
1053157623 9:35791758-35791780 GGGCGGGGCCGCCGTAGCTCCGG + Intergenic
1054798605 9:69325330-69325352 CCACGGGGCAGCAGGAGCCCGGG - Intronic
1057054427 9:91949937-91949959 CCGCGGGAGCGCCGAGCCCCGGG + Exonic
1057432165 9:95004739-95004761 GCGCGGGGCGGCCGGAGCCCGGG + Intronic
1057432189 9:95004791-95004813 GCGCGGGGCGGCCGGAGCCCGGG + Intronic
1057623286 9:96655283-96655305 ACGCGGGGCGGCCGAGGGCCTGG + Intronic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1060192035 9:121599510-121599532 CCGGGTGGCCGCGGGAGCCCGGG + Intronic
1060200970 9:121651649-121651671 CCGAGCGGCCGCCGAGGCCCTGG - Intronic
1060855956 9:126915099-126915121 CCCGAGGGCCGCCGAAGCCGGGG + Intronic
1061248443 9:129413424-129413446 CCGGGGGGCCGCCCGAGCTCCGG + Intergenic
1062116528 9:134812336-134812358 CCACTGAGCCCCCGAAGCCCCGG - Intronic
1062472505 9:136712631-136712653 CCGCGGGGCCCGCGCAGCCCCGG + Exonic
1062718619 9:138023430-138023452 CCGCGGGGCCCCCGGAGGCGCGG + Exonic
1188005003 X:25011156-25011178 GAGCGGGGCCGCCGAAGCCTGGG + Intronic
1189491133 X:41472604-41472626 CCTCGGGGCAGCCGGAGCACAGG + Intronic
1190327813 X:49217599-49217621 TCGGGGGGCCGCCGAAGACTTGG + Intronic
1190440492 X:50470651-50470673 CCGCGGAGCTGCCGCAGCCCAGG - Exonic
1195625171 X:106999805-106999827 CCGCGCGCCCCCCGCAGCCCAGG + Intronic
1196886531 X:120251190-120251212 CCGAGGGGCTGCCGGTGCCCTGG + Intronic
1198082589 X:133253207-133253229 CGGAGGGGCTGCCAAAGCCCTGG - Intergenic
1198480256 X:137034089-137034111 GCACGAGGCCGCCGCAGCCCAGG + Intergenic
1200231115 X:154444382-154444404 GCGCGGGGCCGCCGGGGACCTGG - Intronic
1200233716 X:154458479-154458501 CCCCCGGGCTGCCGGAGCCCCGG - Intronic