ID: 1132893179

View in Genome Browser
Species Human (GRCh38)
Location 16:2214507-2214529
Sequence CCGCGGGGCCGCCGAAGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132893171_1132893179 -5 Left 1132893171 16:2214489-2214511 CCAGGCTGGCGCCGGGCCCCGCG 0: 1
1: 0
2: 1
3: 41
4: 398
Right 1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG 0: 1
1: 0
2: 5
3: 29
4: 214
1132893170_1132893179 -2 Left 1132893170 16:2214486-2214508 CCTCCAGGCTGGCGCCGGGCCCC 0: 1
1: 0
2: 5
3: 40
4: 366
Right 1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG 0: 1
1: 0
2: 5
3: 29
4: 214
1132893167_1132893179 5 Left 1132893167 16:2214479-2214501 CCGAAGACCTCCAGGCTGGCGCC 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG 0: 1
1: 0
2: 5
3: 29
4: 214
1132893165_1132893179 10 Left 1132893165 16:2214474-2214496 CCGTGCCGAAGACCTCCAGGCTG 0: 1
1: 0
2: 3
3: 14
4: 143
Right 1132893179 16:2214507-2214529 CCGCGGGGCCGCCGAAGCCCAGG 0: 1
1: 0
2: 5
3: 29
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132893179 Original CRISPR CCGCGGGGCCGCCGAAGCCC AGG Exonic