ID: 1132894779

View in Genome Browser
Species Human (GRCh38)
Location 16:2223656-2223678
Sequence GCAGAAGCCCAGGCCGAAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132894779 Original CRISPR GCAGAAGCCCAGGCCGAAGC CGG Exonic
900078626 1:837913-837935 GGACAAGCACAGGCTGAAGCAGG - Intergenic
900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG + Intronic
900530256 1:3149528-3149550 GCAGAGGCCCAGGCGGAGTCTGG - Intronic
900942658 1:5811000-5811022 TCAGAAGCCCAGGACAAAGCTGG - Intergenic
901236681 1:7671000-7671022 GCAGCACCCCAGGCTGAATCAGG - Exonic
901574487 1:10189851-10189873 TGAGAAGACCAGGCAGAAGCTGG + Intergenic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
901971436 1:12912075-12912097 GCAGAAGCCCAGGGAGGAGCTGG + Intronic
902013732 1:13289665-13289687 GCAGAAGCCCAGGGAGGAGCTGG - Intergenic
902611004 1:17597105-17597127 GCAGAAGCAGATGCAGAAGCAGG - Intronic
902992251 1:20196455-20196477 GCTGAGGCCCAGGCCTCAGCTGG - Intergenic
904026238 1:27505324-27505346 GCAGAAGCTGAGGCTGCAGCTGG - Intergenic
904334164 1:29786274-29786296 GCCCAAGGCCAGGCTGAAGCAGG - Intergenic
905212367 1:36383431-36383453 AGAGAAGCCCAGGCCAATGCAGG + Intronic
906556594 1:46718999-46719021 GGAGCAGCCGCGGCCGAAGCCGG - Exonic
909367653 1:74846564-74846586 GCAGAAGGCCAAGCCAGAGCAGG + Intergenic
912301858 1:108526086-108526108 ACAGAAGCCCAGGGCTGAGCTGG + Intergenic
914904167 1:151730240-151730262 ACAGAAGCCCAGACCAAAGCAGG + Intergenic
915724140 1:158005848-158005870 GCAGAACCCCAGGCTGTAGAGGG + Intronic
916052924 1:161048724-161048746 GAGGAAGCCCAGGTAGAAGCTGG - Exonic
918913467 1:190604370-190604392 GCAGAAGCCAAAGGGGAAGCAGG - Intergenic
918950054 1:191125692-191125714 ACAGAAGCCGAGGCTGAAGAGGG + Intergenic
920161982 1:204005609-204005631 GCAGAAGGCGAGGCTGCAGCAGG - Intergenic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
920549429 1:206846164-206846186 GGAGGAGCCCAGGCCTCAGCTGG - Intergenic
920577190 1:207070232-207070254 GCAGGAGCCCAGGTGCAAGCTGG - Intronic
920932782 1:210404537-210404559 GCAGAGCTCCAGGCTGAAGCTGG - Exonic
922323292 1:224506399-224506421 GCAGAAGCCAAGGCTGAAGGAGG - Intronic
922363395 1:224843128-224843150 TCAGAAGCCCATGCTGTAGCAGG + Intergenic
922706288 1:227792495-227792517 GGAGAGGCCCTGGCCCAAGCAGG + Intergenic
1063146213 10:3297311-3297333 GCAGAAGGCGAAGCCGGAGCAGG - Intergenic
1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG + Intronic
1063443024 10:6088968-6088990 GCAGGCGCAGAGGCCGAAGCAGG + Intronic
1063900401 10:10726939-10726961 GCGGAAGGCAAAGCCGAAGCAGG + Intergenic
1064055523 10:12094043-12094065 ACAGAAGACCAAGCCGAAACAGG - Intronic
1064258770 10:13767911-13767933 AGAGAAGCCCAGGGCGATGCTGG + Intronic
1064424910 10:15222062-15222084 GCAGAAGGCCAGGGAGAGGCTGG + Intronic
1065244368 10:23742518-23742540 GCAGAAGGCAAAGCAGAAGCAGG + Intronic
1065605587 10:27414214-27414236 GCCCAAGCCCAGGCCGGGGCCGG - Exonic
1072686041 10:97537556-97537578 GCAGCAGCAGAGGCCAAAGCAGG + Intronic
1072757708 10:98031361-98031383 GCAGAGGCCCAGGCGGCTGCGGG + Intergenic
1073990258 10:109254232-109254254 CCAGAAGGCAAAGCCGAAGCAGG + Intergenic
1076135453 10:128042498-128042520 GCAGAGGCCCTGGCAGAGGCTGG - Intronic
1076556271 10:131323290-131323312 GCAGAAGCCCAGGAGGAAAGAGG + Intergenic
1077190679 11:1254898-1254920 GCAGCAGCCCTGGCCGGGGCAGG - Intronic
1077674571 11:4184819-4184841 ACAAAAGCCCAGGGAGAAGCAGG + Intergenic
1078233222 11:9461153-9461175 GCCGGAGCCCGGGCCCAAGCGGG - Intronic
1078405223 11:11064954-11064976 GCAGAGACCCAGCCCCAAGCTGG - Intergenic
1081762113 11:45583966-45583988 GAAGAAGCCGAGTCCAAAGCAGG + Intergenic
1081907141 11:46677358-46677380 GCAGCAGCCCAGGCCCCAGGGGG + Exonic
1083579820 11:63817916-63817938 GCAGCAGCCCAGGAGGCAGCGGG + Exonic
1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG + Intronic
1083901173 11:65644263-65644285 GAAGAGGCCCAGGCAGAAGAGGG + Intronic
1083923784 11:65794025-65794047 GCAGAAGCCCAGGCTGACTGGGG - Exonic
1086485725 11:87299286-87299308 GCAGAAGGCCAAGAGGAAGCAGG + Intronic
1089184231 11:116604002-116604024 GCAGAGCCCCAGGCAGAACCTGG + Intergenic
1089396097 11:118137002-118137024 GCAGCTGCTCAGCCCGAAGCAGG + Exonic
1089812560 11:121143865-121143887 CCAGTAGCCCAGGCTAAAGCTGG - Intronic
1091836233 12:3588063-3588085 GCAGGAGCCCCAGCAGAAGCAGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1094000740 12:25691297-25691319 GCAGAAGGCAATGCGGAAGCAGG - Intergenic
1094041073 12:26122459-26122481 GCAGAAGGGCAGGCAGAAGGGGG + Exonic
1095801487 12:46273656-46273678 GCAGAAGCCAAAGCAGGAGCAGG - Intergenic
1096386097 12:51196283-51196305 GCAGAAGCTGAGGCCAGAGCAGG - Intronic
1096535176 12:52267443-52267465 GCAGAAGGCCAGGCAGTACCAGG + Intronic
1096675835 12:53225377-53225399 GCAGAGGCCCAGGGAGATGCTGG + Intronic
1101467543 12:104963007-104963029 GCGGAAGCCAGGGCGGAAGCAGG + Intergenic
1102531945 12:113553174-113553196 GCAGACGCCCAGGCCGCAATGGG - Intergenic
1102651435 12:114445257-114445279 GCAGCAGCCGAAGTCGAAGCCGG - Intergenic
1103521082 12:121537406-121537428 GCCGAGGCCCAGGCGGAAGCCGG - Intronic
1104269797 12:127272909-127272931 GCAGAAGTCAAGGACTAAGCAGG - Intergenic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1105345178 13:19564950-19564972 GCAGAAGCCCAGGCCTCGGCTGG + Intergenic
1108596125 13:51951138-51951160 GCAGCAGCCCAAGCGGAAGATGG + Intronic
1109171786 13:59106584-59106606 GCAGAAGCCAAAGGAGAAGCAGG - Intergenic
1109968502 13:69734250-69734272 GCAGAAGGCCAGGGGGGAGCAGG - Intronic
1110471037 13:75860766-75860788 GCAGAAGGACAGGCAAAAGCAGG + Intergenic
1111918242 13:94383844-94383866 GCAGAAGACAAAGGCGAAGCAGG + Intronic
1112412551 13:99176798-99176820 GCAGAAGCCGAGGTAGAACCGGG - Intergenic
1113779488 13:112968200-112968222 GCAGAAGCTGAGGCAGAAGCAGG - Intronic
1114793340 14:25683643-25683665 GGAGAAGACCAGGCCTAAGTGGG + Intergenic
1117529908 14:56650234-56650256 GCCGAAGTCCAGGCAGAAGTTGG - Intronic
1118102254 14:62619913-62619935 GCAGAAGCCCAAGCTGTATCAGG + Intergenic
1118314562 14:64717751-64717773 GCAGAAGCCCAGGAAGGTGCTGG - Intronic
1119434238 14:74587413-74587435 GCAGGGGTCCAGGCCGAACCAGG + Intronic
1120799903 14:88676320-88676342 GCAGAAGCCAAAGGAGAAGCAGG + Intronic
1121235160 14:92386795-92386817 CCAGCAGCCCAGGCCACAGCCGG - Intronic
1121534739 14:94683822-94683844 GCAGAAACGCTGGCCGCAGCTGG - Intergenic
1121814005 14:96915231-96915253 GCAGAAGGCAAAGCAGAAGCAGG - Intronic
1122975487 14:105169051-105169073 GCAGGAGCCCAGGCGGAGGAGGG - Intergenic
1124210778 15:27763663-27763685 GCAGATGCCCAGGGCACAGCTGG + Intronic
1125081906 15:35684601-35684623 GCAGAAGGCAAGGCGGGAGCAGG + Intergenic
1125209610 15:37197845-37197867 GCAGAAGACAAAGCAGAAGCAGG + Intergenic
1126009487 15:44288958-44288980 GCAGAAGCCCAGGCCTCGGCTGG - Exonic
1126802648 15:52313708-52313730 AATGAAGCCCAGGCCGAGGCTGG + Exonic
1127390939 15:58504576-58504598 GGAGAAGGCCAGGTCGATGCTGG - Intronic
1127641432 15:60919321-60919343 GGAGAAGCCCAGGGCCCAGCAGG + Intronic
1127871633 15:63079028-63079050 GCTGGAGTCCAGGCCGGAGCAGG - Intergenic
1129170950 15:73807479-73807501 GCAGAAACCCAGTCCCCAGCAGG - Intergenic
1129270683 15:74417818-74417840 GCAGAAGCCCACGCAGTAGAAGG + Intronic
1130147108 15:81282642-81282664 GCCGATGCCCAGGCCCACGCCGG - Exonic
1130546943 15:84863600-84863622 GCAGAAGCCCGGGCCGCGCCTGG + Exonic
1131272688 15:90956757-90956779 GCAGAAACCGAAGCCGAACCAGG - Exonic
1132120298 15:99169910-99169932 GCAAGAGCCCAGGCCGCAGATGG + Intronic
1132210824 15:100020922-100020944 GGAGAAGCCCAGGAGGAAGCAGG - Intronic
1132500626 16:283178-283200 GCAGCAGTACAGGCAGAAGCTGG - Exonic
1132878557 16:2150864-2150886 GCAGGAGCTCAGGCTGAAGGAGG + Intronic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1132956975 16:2599468-2599490 GCAGCAGCCAAGGCCCAGGCAGG - Exonic
1132969326 16:2677921-2677943 GCAGCAGCCAAGGCCCAGGCAGG - Intergenic
1133035432 16:3031412-3031434 CCAGAAGCCCCGGCAGCAGCTGG - Intronic
1134094596 16:11411187-11411209 CCAGATGCCCAGCCCGAGGCAGG - Intronic
1135089305 16:19500175-19500197 GTAGAAGCCCAAGCAGCAGCCGG - Intergenic
1136189919 16:28609470-28609492 GCAAAAGCACAGGCCTAGGCAGG + Intronic
1136460418 16:30407259-30407281 GGAGAGGCCCAGGCCGGGGCGGG + Intergenic
1137967992 16:52955759-52955781 GTAGAAGGCCAGGTGGAAGCAGG - Intergenic
1138235197 16:55376587-55376609 TCAAAAGCCCAGGGGGAAGCTGG + Intergenic
1138310849 16:56022662-56022684 GCAGAAGCCCAGGCTTCATCTGG + Intergenic
1139942048 16:70612369-70612391 GCAGAGGCCAAGGCCCAAGCTGG + Intronic
1142115752 16:88355308-88355330 GCAGAAACCGAGGCCCAAGAAGG - Intergenic
1142304917 16:89279682-89279704 GCACAAGCTCAGGCCGCAGACGG - Exonic
1142753127 17:2000076-2000098 GCAGCAGCCCTGGCCCAGGCAGG - Intronic
1144766059 17:17733153-17733175 GCAGGAACCCAGGTCTAAGCAGG - Intronic
1147769611 17:42858429-42858451 CCAGAAGCCCAGGCCAGGGCAGG + Intergenic
1151135594 17:71943378-71943400 GCAGAACACCAGGCCAAAGACGG + Intergenic
1151559511 17:74862855-74862877 GGGGAAGCCCAGGGAGAAGCTGG - Exonic
1151957561 17:77388025-77388047 GCAGAAGCCCAGGGAGGAGTAGG - Intronic
1152399686 17:80058405-80058427 GCAGAGACCCAGGAGGAAGCAGG - Intronic
1154168348 18:12032911-12032933 GCAGAAGCAGAAGCAGAAGCAGG - Intergenic
1155906939 18:31462986-31463008 GGAGAAGCCCAGGCAGCAGTGGG + Intronic
1157286728 18:46382061-46382083 ACAGATGCCCAGGCTGAGGCAGG - Intronic
1157463469 18:47923851-47923873 GCACAACCTCAGGCCAAAGCTGG + Intronic
1157792500 18:50545402-50545424 GCAGAAGCCCAACTCGAAGATGG - Intergenic
1157815327 18:50725696-50725718 GGAGAAACCCAGGCTGAGGCTGG + Intronic
1157887684 18:51384394-51384416 GCAGGAGCCCAGGCCATGGCAGG + Intergenic
1159743995 18:72209408-72209430 GCAGGAGCCCACGGCGAGGCGGG - Intergenic
1160012560 18:75116928-75116950 GCAGAAGCCAAGGCAGTGGCAGG + Intergenic
1160127952 18:76195815-76195837 GCAGAGGCCAAGGCTCAAGCAGG + Intergenic
1160496953 18:79381355-79381377 GCAGAAGCCCAGGAGGAAGGGGG + Intergenic
1160510677 18:79451836-79451858 GCCGAAGCCCAGGCCGCAGATGG - Intronic
1160710166 19:547751-547773 GCAGAAGCCCCCGCCTAAGTTGG - Intronic
1160828590 19:1092016-1092038 GCGGAAGCCGAGGCCCGAGCAGG - Intronic
1160988577 19:1851521-1851543 GCAGAAAACCAGGCAGGAGCTGG + Intergenic
1161168247 19:2800067-2800089 GCGGAAGCCCAGGCCGGACGGGG + Intronic
1161976914 19:7612222-7612244 GCAGAGGCTGAGGCCGGAGCGGG + Exonic
1161997728 19:7724206-7724228 GCAGAAGACAAAGGCGAAGCAGG + Intergenic
1162056226 19:8065751-8065773 ACAGAGGCCCAGGCAGAGGCCGG + Exonic
1163592559 19:18202795-18202817 GCCCAAGCCCAGGCAGAAGATGG + Intronic
1164146216 19:22514193-22514215 GCAGAAGTCCAGGCTAAATCTGG + Intronic
1165837993 19:38771003-38771025 GCAGAAGCCCAGGCGGGCCCGGG - Exonic
1165841572 19:38791694-38791716 GCAGAAGCCCAGGCGGGCCCGGG + Exonic
1165959582 19:39523013-39523035 ACAGAACCCAAGGCCCAAGCGGG + Intergenic
1167302185 19:48684495-48684517 ACAAAAGCCCAAGCAGAAGCTGG + Intergenic
1167586510 19:50378477-50378499 GCAGAACCCCAGGGCTAGGCGGG - Intronic
1168640164 19:58025864-58025886 GGAGAAGCCCAGCCTGAGGCTGG + Intergenic
924998771 2:387009-387031 GCAGAAGCCCAGGACAGAGAAGG - Intergenic
925666178 2:6258729-6258751 GCAGATGCAGAGGCCCAAGCTGG + Intergenic
926109596 2:10173512-10173534 GCAGAGGCCCAGCCCAATGCAGG + Intronic
926671648 2:15582312-15582334 GAAAAAGCCCAGGCTGCAGCTGG + Intergenic
927087771 2:19688367-19688389 GCAGTAGCCCAGGCCCAGGCAGG + Intergenic
927182566 2:20457293-20457315 GCAGAGGCCCAGGGTGAATCTGG - Intergenic
930274240 2:49293128-49293150 GCAGAAGGCCAAGGAGAAGCAGG - Intergenic
930321821 2:49864612-49864634 GCTGATGCCCAGGCAGAAGTGGG + Intergenic
932417343 2:71581462-71581484 CCAGGAGCCCAGGCCAAAGGAGG - Intronic
932430878 2:71672901-71672923 GCAGCAGTCCAGGCCGTGGCTGG + Intronic
932618275 2:73249948-73249970 GCAGAAGACCAGACCCAGGCAGG - Intronic
934554454 2:95279957-95279979 CCAGAAGCCAAGGGCGAGGCTGG + Exonic
935236928 2:101147076-101147098 GCCGAGGCCGAGGCCGAGGCAGG + Intronic
936721587 2:115257435-115257457 GCAGAAGGCAAGGGGGAAGCAGG + Intronic
938540001 2:132278087-132278109 TCTGACGCCCAGGCTGAAGCTGG - Intergenic
938780742 2:134582602-134582624 TCAGAAACCCAAGCCCAAGCTGG + Intronic
939091153 2:137781414-137781436 GCAGAAGGCAAAGCAGAAGCAGG + Intergenic
939706000 2:145454432-145454454 GCAGAAGGCAAAGCCAAAGCAGG - Intergenic
940269306 2:151874036-151874058 GCAGAAGGCCAAGCGGGAGCAGG - Intronic
940848871 2:158669848-158669870 GCAAAAGCCCTGGCCGACTCAGG + Exonic
940912825 2:159224198-159224220 GCAGAAGCCTAAGCAGCAGCTGG - Intronic
943658698 2:190534905-190534927 GCCGAGGCCGAGGCCGAGGCCGG - Intergenic
944953390 2:204778748-204778770 GCAGAAGTCCAGGCAGGAGATGG - Intronic
947654138 2:231811708-231811730 GCAGAATCCCAGGAAGAAACAGG - Intergenic
948163013 2:235840587-235840609 GCAGGAGCCCAGGCAGGAGGTGG + Intronic
948334131 2:237194360-237194382 GCACAATCCCTGGCCCAAGCTGG + Intergenic
948871077 2:240798508-240798530 GGTAAAGGCCAGGCCGAAGCTGG - Intronic
948911938 2:241009278-241009300 GCAGCAGCCCAGGCTGGAGATGG + Intronic
1169342808 20:4809455-4809477 GCTGAAGGGCAGGCCGAAGTGGG - Intronic
1169358066 20:4924493-4924515 GCAGGAGGCCAGGCAGGAGCTGG - Intronic
1169899140 20:10535143-10535165 GCAGAAGGCCAGGCTGGAGCAGG + Intronic
1169909792 20:10637915-10637937 GCAGAAGCACATGGCAAAGCCGG + Exonic
1172272603 20:33663182-33663204 GCAGAAGCCCTGGACCAGGCGGG + Intronic
1173058309 20:39637293-39637315 GCAGGACTCCAGGCCGGAGCAGG - Intergenic
1173411664 20:42816684-42816706 GCAGAAGGCGAGGGGGAAGCAGG - Intronic
1173622748 20:44449169-44449191 TCAGATGCCCAGGCAGAAGCCGG - Intergenic
1175405417 20:58722881-58722903 GCAAAAGCCCAGGCTGGAGTGGG + Intergenic
1175894400 20:62329660-62329682 GCACAAGGCCAGGCCTCAGCAGG + Intronic
1176512546 21:7759632-7759654 ACAGGACCCCAGGCCGCAGCAGG - Intronic
1176667120 21:9697967-9697989 GCTGAACCCCAGGCAGAAGCCGG - Intergenic
1177255914 21:18662793-18662815 CCAGAAGCCCAGGCAGGAACAGG - Intergenic
1177739560 21:25136958-25136980 GCAGAAGGCCAAGGGGAAGCAGG + Intergenic
1178646659 21:34390156-34390178 ACAGGACCCCAGGCCGCAGCAGG - Intronic
1179507997 21:41854584-41854606 GGACAAGCCCATGCTGAAGCAGG - Exonic
1179510668 21:41871267-41871289 GCAGAACCCCTGGACGAGGCTGG - Intronic
1179550249 21:42139299-42139321 GCAGAAGACCAAGGGGAAGCAGG + Intronic
1179563444 21:42231746-42231768 GCAGATGCTCAGGCTGAAGGGGG + Intronic
1179663578 21:42893610-42893632 CCCGAGGCCCAGGCCGAGGCTGG + Intronic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1180721986 22:17916267-17916289 TCAGAAGCACAGGCAGAGGCTGG - Intronic
1181050356 22:20235421-20235443 GCAGCAGCCCAGGCCCAGGCAGG + Intergenic
1181388840 22:22564571-22564593 GCAGATGCTCTGGCCCAAGCTGG - Exonic
1181530564 22:23514727-23514749 GGAGAAGCTGAGGCCCAAGCAGG + Intergenic
1181802011 22:25353970-25353992 GCAGGACCCCAGGCCCCAGCCGG + Intronic
1183437115 22:37802677-37802699 GCAGAGGCCGAAGCCGAGGCGGG - Intergenic
1183831502 22:40420607-40420629 GCAGAGGCCACGGGCGAAGCTGG - Intronic
1184155094 22:42662228-42662250 GCAGAACCCCCAGCCGAAGCCGG - Intergenic
1184409508 22:44318423-44318445 GCAGAATGCCAGGGGGAAGCGGG + Intergenic
1184825641 22:46948994-46949016 GCAGAAGCCCTGTGGGAAGCAGG + Intronic
1185056921 22:48586025-48586047 GCAGGGGCAGAGGCCGAAGCTGG - Intronic
1185093144 22:48786943-48786965 GCAGAACCCCAAGCCGGACCTGG - Intronic
950119937 3:10475036-10475058 GCAGAAGCCCAGGCTGAAACTGG - Intronic
951272958 3:20650008-20650030 GCAGAAGCCAAAGAGGAAGCAGG - Intergenic
952346058 3:32486913-32486935 GCAGAAGGCGAGGCGGAAGCAGG - Intronic
953129341 3:40123527-40123549 ACAGCAGCCCAGGCTGAAGCAGG + Intronic
954575669 3:51674711-51674733 GCAGAAGTCCAGGCTAAATCTGG - Intronic
955672446 3:61415998-61416020 GCAGAAGTGCAGGGCGAAGGAGG + Intergenic
959631425 3:108511339-108511361 GAAGAAGCCCAGGCTGAAGGTGG + Intronic
960077960 3:113509929-113509951 GCAGAAGGCCAAACAGAAGCAGG - Intronic
960949950 3:122992879-122992901 GCCAAAGCCCAGGCAGCAGCTGG + Intronic
961697117 3:128713001-128713023 GCAGAAGGCCAGGGGGGAGCAGG + Intergenic
961749240 3:129085870-129085892 GCAGAGGCCCAGGCAGGAGGTGG + Intergenic
961932386 3:130547553-130547575 GCAGATGCCGAGGCCGAGGAGGG + Intergenic
962318538 3:134373576-134373598 GCAGGAGCCCAGGCCAAGGCTGG - Intronic
962353919 3:134677667-134677689 GCAGCAGCCCAGGGAGAAGGAGG - Intronic
962814054 3:138982772-138982794 GGAGAAGCCCAGGGCGTGGCCGG + Intergenic
964567703 3:158075736-158075758 GCAGAAGGCAAAGCCGGAGCAGG - Intergenic
967548703 3:190763845-190763867 GCAGAAGGCAAAGCAGAAGCAGG - Intergenic
967583238 3:191185220-191185242 GCAGAAGCCAAAGGGGAAGCAGG + Intergenic
967728884 3:192888318-192888340 GCAGAGGCCCAGGCAAGAGCTGG + Intronic
968181676 3:196599528-196599550 GTGGAAGCCCAGGCAGAGGCGGG + Intergenic
969281298 4:6172450-6172472 GAAGAAACCCAGGCCAGAGCTGG - Intronic
969447670 4:7254760-7254782 GCAGAACCCGAGGTCCAAGCAGG - Intronic
969484149 4:7462472-7462494 GCAGAAGCCCAGATAAAAGCAGG + Intronic
969519445 4:7667413-7667435 GCAGAGGCCTAGGATGAAGCTGG - Intronic
970131595 4:12877123-12877145 GCAAAACCCCACGCTGAAGCTGG - Intergenic
970462921 4:16293572-16293594 GCAGAAGAGCAGGCCACAGCTGG + Intergenic
971164242 4:24166242-24166264 GCAGAAGAAAAGTCCGAAGCTGG + Intergenic
981355252 4:143782867-143782889 GCAGAACCTCAGGCCACAGCAGG + Intergenic
982795804 4:159642198-159642220 GCAGAAGGCCAAGGGGAAGCTGG + Intergenic
984571717 4:181403443-181403465 GCAGAAGGCAAGGGGGAAGCAGG + Intergenic
984852390 4:184165380-184165402 GCAGAACCCCAGTCCCAACCAGG + Intronic
985230799 4:187814439-187814461 GCAGCATCCCAGGCCCAAGGGGG - Intergenic
985508114 5:296321-296343 GCAGAGGCCCAGGGTGAAGTGGG - Intronic
985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG + Intergenic
985739922 5:1609348-1609370 GCAGAGGCCCAGGGTGAAGTGGG + Intergenic
985807726 5:2059463-2059485 GCAGAGGACAAGCCCGAAGCAGG + Intergenic
985808934 5:2069023-2069045 GCAGGGGCCAAGCCCGAAGCAGG - Intergenic
986086620 5:4458680-4458702 GCAGAAGGTCAGGGGGAAGCAGG + Intergenic
986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG + Exonic
987064987 5:14281267-14281289 GCAGAAGGCAAGGGGGAAGCAGG + Intronic
987685790 5:21199108-21199130 ACACATGCCCAGGCTGAAGCTGG - Intergenic
991483918 5:67114126-67114148 GCAGAAGGCCATGCCAAAGAAGG + Exonic
991562324 5:67966777-67966799 CCAGAAGCCCAGGCCCTACCTGG + Intergenic
991585449 5:68197033-68197055 TCAGAAGCCCAGTCAGCAGCAGG + Intronic
992532961 5:77670307-77670329 GCCGAGGCCGAGGCCGAGGCAGG - Intergenic
993032240 5:82718030-82718052 GCAGAAGGCAAGGGGGAAGCTGG - Intergenic
994047850 5:95329485-95329507 GCAGAAGCTCAGACAGCAGCAGG - Intergenic
994869657 5:105331493-105331515 GCAGAAGCAGAGGTAGAAGCAGG + Intergenic
996052758 5:118951253-118951275 GCAGAAGCCGAGGAAGAAGTGGG + Intronic
996421111 5:123263756-123263778 GCATAAGCCCAGGCTGATGTTGG - Intergenic
997329302 5:133047547-133047569 GGAGAAGCACAGGCAGGAGCCGG + Intergenic
998040001 5:138945822-138945844 GCAGGAGTCCAGGCTGATGCTGG - Intergenic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
999045610 5:148465886-148465908 GCAGAAGAGCAGGAGGAAGCTGG + Intronic
1001651664 5:173320275-173320297 CCAGAAGCCCAGGGCGGATCTGG + Intronic
1005048826 6:21665779-21665801 GCGGAGGCCCCGGCCGAACCCGG + Intergenic
1005416547 6:25606129-25606151 GCAGAACCCAAAGCGGAAGCAGG + Exonic
1006738479 6:36291728-36291750 ACAGAAGCCCAGGACGAACCAGG + Intronic
1007732369 6:43954879-43954901 CCAGAAGCCCAGGCTGCAGAGGG - Intergenic
1014787015 6:125630903-125630925 GCAGAGGCCCAGGGTGAAGTGGG + Intergenic
1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG + Intergenic
1014928919 6:127309792-127309814 GCAGAAGGCGAAGCGGAAGCAGG + Intronic
1016730291 6:147421127-147421149 ACAGAATCCCAGGCAGAAGCAGG - Intergenic
1016911592 6:149204686-149204708 GCAGAAGGCAAAGGCGAAGCAGG + Intergenic
1017922677 6:158885704-158885726 GTAGAAGCCCATGCTGTAGCAGG + Intronic
1018787300 6:167118027-167118049 GCAGAAGGACAGACTGAAGCTGG - Intergenic
1019293002 7:259341-259363 GCGGCAGACCACGCCGAAGCAGG + Intronic
1019777265 7:2919252-2919274 AGAGAAGCCCAGGCCAAAGAAGG - Intronic
1019955354 7:4410144-4410166 GCAGAAGGCTAAGGCGAAGCCGG + Intergenic
1021838862 7:24706304-24706326 GCTGAAGCCCCGGCAGCAGCAGG - Exonic
1022040359 7:26575541-26575563 GAAAAAGACCAGGCCGAGGCAGG - Intergenic
1022578030 7:31517670-31517692 GGAGAAGCGCAGGCGGCAGCCGG - Intronic
1022875299 7:34521604-34521626 GCAGAAGGCAAAGCTGAAGCAGG - Intergenic
1024349729 7:48351516-48351538 GCAGAAACCCAGGGAGAAGATGG - Intronic
1025106444 7:56175127-56175149 GCAGAGGCCGAGGCCGGAGCAGG - Intergenic
1029443613 7:100601201-100601223 GCAGGAGCCCAGGCAGGGGCAGG + Intergenic
1031774497 7:125890459-125890481 GCAGAAGCCCAAGGAGAAGTAGG - Intergenic
1032920781 7:136544137-136544159 GCAGAAGCAGAAGCAGAAGCAGG - Intergenic
1033563937 7:142560554-142560576 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1033564326 7:142563868-142563890 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1033763423 7:144461658-144461680 GCAGAAGGCAAGGCAGAAGCAGG - Intronic
1035527018 8:321832-321854 GGACAAGCACAGGCTGAAGCAGG + Intergenic
1036083823 8:5590775-5590797 GCAGGAGTCCGGGCCAAAGCTGG - Intergenic
1036635770 8:10548674-10548696 ACAGAAGCCCAGGCACAAGGTGG + Intronic
1036690106 8:10939885-10939907 CCCGAAGCCCAGGGAGAAGCTGG - Intronic
1037337858 8:17809163-17809185 GCAGAAGGCAAGGGAGAAGCAGG + Intergenic
1037711798 8:21360969-21360991 GCAGATGCCAAGGCAGAACCGGG - Intergenic
1039340779 8:36647507-36647529 GGAGAAGCCCAGGAAGAAGCAGG + Intergenic
1039405254 8:37307167-37307189 GCAGAAGCTCAGGTCTAAGGGGG + Intergenic
1039454388 8:37697645-37697667 GCCCAAGCCCAGCCCGGAGCCGG + Exonic
1040551155 8:48438697-48438719 GGAGTAGCCCCGGCCGAGGCTGG + Intergenic
1042020689 8:64369822-64369844 GGAGCGGCCCAGGCCCAAGCAGG - Intergenic
1043000105 8:74748184-74748206 GCAGAAACTCAGTCAGAAGCTGG + Intronic
1048270681 8:133025807-133025829 GCAGAATCCTAGGCTGAGGCTGG - Intronic
1048297536 8:133225462-133225484 GGAGACCCCCAGGCCGCAGCTGG - Exonic
1049269057 8:141684496-141684518 GCTGAATCCCTGTCCGAAGCAGG + Intergenic
1049536348 8:143184171-143184193 GCAGGGGCCCAGCCCGAGGCGGG + Intergenic
1049536763 8:143186127-143186149 CCCGACGCCCAGGCCGGAGCCGG - Intergenic
1049668510 8:143859323-143859345 GCCGAGGCCGAGGCCGAGGCCGG - Exonic
1049776455 8:144408079-144408101 TCAGAAGCTCAGGCCAAAGGAGG - Intronic
1052192668 9:25677667-25677689 GCTGTAGCCGAGGCCGCAGCCGG - Exonic
1053083612 9:35198363-35198385 GCAGAAGGCCAAGGAGAAGCAGG - Intronic
1055796805 9:79983302-79983324 GCAGGAGCCCAGGGGGTAGCAGG + Intergenic
1056507402 9:87270286-87270308 ACAGAAGCCCAGGCCGGCGCTGG + Intergenic
1056552491 9:87663592-87663614 GCAGAGGCCTAGGGAGAAGCAGG - Intronic
1057046922 9:91893198-91893220 ACAGAACCCCAGGCTGAAGCTGG + Intronic
1057466413 9:95317880-95317902 GCGGAAGCCCCGGCGGGAGCAGG + Intergenic
1057478696 9:95426957-95426979 GCAGGAACCCGGGCAGAAGCCGG - Intergenic
1057557909 9:96102285-96102307 ACAGAAGGCCAGGGGGAAGCAGG + Intergenic
1057838488 9:98466072-98466094 GCAGAAGGCAAAGCGGAAGCAGG - Intronic
1059335959 9:113568638-113568660 GCTGCAGCCCAAGCCGAAGCTGG + Intronic
1060144817 9:121242883-121242905 GCAGAAGCCCAGGAGCAGGCAGG - Intronic
1060149959 9:121282183-121282205 GGAGAAACCGAGGCTGAAGCTGG - Intronic
1060236016 9:121863093-121863115 GCAGGAGCCCAGGAGGAAGCAGG - Intronic
1060634569 9:125189775-125189797 GCAGCGGCGGAGGCCGAAGCCGG + Exonic
1061249790 9:129420099-129420121 GGAGAAGCTGAGGCCCAAGCAGG - Intergenic
1061922017 9:133787660-133787682 GCAGAAGCCTCAGCTGAAGCAGG + Intronic
1062008363 9:134253016-134253038 TCAGGAGCCCAGGCGGTAGCAGG - Intergenic
1062209684 9:135356877-135356899 GCAGCAGCCAAGGCCTCAGCTGG + Intergenic
1062294746 9:135818459-135818481 GAAGAAGCCGCGGCCGAAGTCGG - Exonic
1062325923 9:136012461-136012483 GCAGGAGCCCAGGCCAAGGCCGG + Intronic
1062341381 9:136095203-136095225 GCAGCTGCCCAGGCCGGACCGGG - Exonic
1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG + Intergenic
1185788123 X:2907550-2907572 GCAGACGCCTCGGCCGTAGCAGG + Exonic
1186251307 X:7669741-7669763 GCAGAATCCCAAGGCGATGCAGG - Intergenic
1186461107 X:9749282-9749304 GCAGAAGGCCAAGGGGAAGCAGG - Intronic
1188879304 X:35472268-35472290 GCAGAACACCAAGCCGAAGTAGG + Intergenic
1189293146 X:39900124-39900146 GCAGAAGCCCAGACATAAGTGGG - Intergenic
1189896385 X:45660641-45660663 GCAGAAGGCAAAGCAGAAGCAGG - Intergenic
1190247515 X:48700282-48700304 GCAGAAGGCCAAGCAGAGGCGGG + Exonic
1190881683 X:54496120-54496142 GCCGAGACCCAGGCTGAAGCTGG - Exonic
1192362863 X:70450160-70450182 GCTGAAACCCAGGCCTGAGCGGG - Exonic
1193813995 X:86084148-86084170 GCAGAAGGCAAAGCAGAAGCAGG - Intergenic
1193921945 X:87438875-87438897 GCAGAAGGCGAAGCAGAAGCAGG - Intergenic
1197649730 X:129051659-129051681 GCAGAAGGCAAAGCAGAAGCAGG + Intergenic
1198177758 X:134172714-134172736 GCAGAGGCCGTGGCCGGAGCCGG + Intergenic
1198228688 X:134669768-134669790 GCGGAAGACAAGGCTGAAGCGGG + Intronic
1199336191 X:146620719-146620741 GCACAAGCTCAGGCCGCAGACGG - Intergenic
1200087017 X:153611919-153611941 ACAGAAGCCCGGACGGAAGCAGG - Intergenic
1201481004 Y:14439601-14439623 GCAGAATCCCAGGCTGAGTCAGG - Intergenic