ID: 1132896343

View in Genome Browser
Species Human (GRCh38)
Location 16:2231039-2231061
Sequence TACCCAGGATGCCCGCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132896343_1132896347 -5 Left 1132896343 16:2231039-2231061 CCCCTTTGCGGGCATCCTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1132896347 16:2231057-2231079 GGGTACTCTGTGTGTGCCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 244
1132896343_1132896355 27 Left 1132896343 16:2231039-2231061 CCCCTTTGCGGGCATCCTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1132896355 16:2231089-2231111 AGGCCCGGTGGGCTTAGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
1132896343_1132896351 12 Left 1132896343 16:2231039-2231061 CCCCTTTGCGGGCATCCTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1132896351 16:2231074-2231096 CCTTGGCCAGTCAGCAGGCCCGG 0: 1
1: 0
2: 1
3: 20
4: 263
1132896343_1132896352 15 Left 1132896343 16:2231039-2231061 CCCCTTTGCGGGCATCCTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1132896352 16:2231077-2231099 TGGCCAGTCAGCAGGCCCGGTGG 0: 1
1: 0
2: 0
3: 15
4: 201
1132896343_1132896356 28 Left 1132896343 16:2231039-2231061 CCCCTTTGCGGGCATCCTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1132896356 16:2231090-2231112 GGCCCGGTGGGCTTAGTCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1132896343_1132896353 16 Left 1132896343 16:2231039-2231061 CCCCTTTGCGGGCATCCTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1132896353 16:2231078-2231100 GGCCAGTCAGCAGGCCCGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 130
1132896343_1132896348 7 Left 1132896343 16:2231039-2231061 CCCCTTTGCGGGCATCCTGGGTA 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1132896348 16:2231069-2231091 TGTGCCCTTGGCCAGTCAGCAGG 0: 1
1: 0
2: 3
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132896343 Original CRISPR TACCCAGGATGCCCGCAAAG GGG (reversed) Intronic
906294419 1:44640599-44640621 TATCGAGGAGGCCCGGAAAGTGG + Intronic
909113845 1:71509838-71509860 TACTTGGGATGCCCTCAAAGGGG + Intronic
924587272 1:245371072-245371094 TACCCAGGATGACCACAAGTTGG - Intronic
1064783386 10:18867383-18867405 AACACAGGCTGCCAGCAAAGGGG + Intergenic
1072036249 10:91565603-91565625 TACCCAGGACACCCTCAAATGGG - Intergenic
1073261638 10:102195070-102195092 TACTCAAGATGCCCTCAAGGGGG - Intergenic
1076253149 10:128998814-128998836 TTCCCAGGAGGCCCGCAGAAGGG - Intergenic
1086984673 11:93234780-93234802 TACCCAGACTGCCCTCAGAGTGG + Intergenic
1087163194 11:94971459-94971481 TACTCAGGATGCCCCTGAAGAGG - Exonic
1089386019 11:118068597-118068619 TCCCCAGGCTGCCTGCAGAGGGG - Intergenic
1094878699 12:34686192-34686214 TTCCCAGGAAGGCCTCAAAGAGG - Intergenic
1095951471 12:47784086-47784108 CAGCCAGGATGCCCACAGAGAGG + Exonic
1096615591 12:52831503-52831525 TACCCAGGTAGGCCTCAAAGAGG + Exonic
1098967252 12:76803879-76803901 TACTTGGGATGCCCTCAAAGGGG + Intronic
1099453727 12:82839208-82839230 TCCCCAGGATGCCCTCAGAGGGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1111044437 13:82796374-82796396 TATTCAGGCTGCCCTCAAAGTGG + Intergenic
1113952324 13:114078964-114078986 TCCCCAGGATGCCTGCAGGGAGG - Intronic
1122854808 14:104554946-104554968 CACCCAGGAAGCCCTCAGAGTGG + Intronic
1132882784 16:2169845-2169867 TACCCAGGCTGCCGGGAAGGGGG + Intronic
1132896343 16:2231039-2231061 TACCCAGGATGCCCGCAAAGGGG - Intronic
1135857323 16:26023907-26023929 TACCCAGAATGACCTCACAGAGG - Intronic
1138138619 16:54546740-54546762 CACACACGATGCCAGCAAAGAGG + Intergenic
1139696988 16:68682157-68682179 TACCCTGAAACCCCGCAAAGTGG + Intronic
1146884085 17:36459416-36459438 GACCCAGCATGGCCGGAAAGGGG - Intergenic
1151305465 17:73260335-73260357 TAACCAGGCTGCCTGGAAAGGGG - Intronic
1152367696 17:79866109-79866131 TTCCCAGGATGCCACCAAACTGG - Intergenic
1155687524 18:28573946-28573968 TATTAAGGATCCCCGCAAAGGGG - Intergenic
1160849451 19:1183447-1183469 CCCCCAGGATGCCCCCAAACCGG + Intronic
1163807674 19:19409788-19409810 TCCCCAGCATCCCCGCAAACAGG + Intronic
1164730913 19:30503812-30503834 TACCCAGGTGGCCTGCAAAGAGG - Intronic
1166832210 19:45645502-45645524 TCCCCAGGATGCCCAGAAAGGGG + Exonic
926978004 2:18534171-18534193 TACCAGGGATGCACACAAAGAGG - Intergenic
933475094 2:82779474-82779496 TAATCAGGATGCCTTCAAAGGGG + Intergenic
933973715 2:87490779-87490801 GACCCAGGATGCCAGGAAGGGGG + Intergenic
936320009 2:111459435-111459457 GACCCAGGATGCCAGGAACGGGG - Intergenic
937097552 2:119245580-119245602 TACCCAGGATGCCCACTTTGGGG - Exonic
937686543 2:124704259-124704281 TCCCCAGGGGGCCCGCAGAGGGG + Intronic
938700797 2:133877582-133877604 AACCCAGTATGCCAGCAAAAAGG - Intergenic
939043586 2:137222850-137222872 GACCCAGGAAGCCAGCAATGTGG - Intronic
1168928046 20:1598973-1598995 TACCCAGGATGCCATCCCAGAGG + Intronic
954661720 3:52230129-52230151 TCCCCAGGAAGCCCTCAAACAGG + Intronic
960059264 3:113303154-113303176 TTGCCAGGTTGCCCCCAAAGTGG - Intronic
962364738 3:134771163-134771185 TATTCAGGAAGCCAGCAAAGTGG - Intronic
978957253 4:114629402-114629424 TACCCTGAATGCCTGAAAAGTGG + Intronic
987818810 5:22935421-22935443 TACCCAGGATGCCCTCTTTGGGG - Intergenic
997735565 5:136210196-136210218 TACCCAGGAAGCCTGGACAGGGG + Intergenic
1002508868 5:179699407-179699429 TGCCCAGGCAGCCGGCAAAGAGG - Intronic
1005116945 6:22349322-22349344 ACCCCAGGAAGCCAGCAAAGTGG + Intergenic
1006826318 6:36938835-36938857 TTCCCAGGAGGCCTGAAAAGGGG - Intergenic
1009255354 6:61385418-61385440 TTCCAAGGATGGCCTCAAAGTGG - Intergenic
1013710831 6:112896178-112896200 TCCCCAGGATGCCCTTCAAGGGG - Intergenic
1016720819 6:147295568-147295590 AACCCAGGATGACGGCATAGAGG + Intronic
1019530220 7:1499476-1499498 CACCCAGGTCGCCCGCAACGCGG + Exonic
1022850737 7:34259129-34259151 TACCCAGAATGACCACAAAGTGG + Intergenic
1024061297 7:45700515-45700537 ACCCTGGGATGCCCGCAAAGAGG + Intronic
1030201082 7:106905228-106905250 TATCCGGGATGCCCTCACAGTGG + Exonic
1032617338 7:133488436-133488458 TACCCTGGGTGCCCACACAGAGG - Intronic
1037219081 8:16495334-16495356 TACTCAGCATGCAAGCAAAGAGG - Intronic
1037358785 8:18051784-18051806 TAGCCAAGATGCCTCCAAAGTGG - Intergenic
1037882118 8:22578572-22578594 TGCCTGGAATGCCCGCAAAGGGG - Intronic
1052444359 9:28541207-28541229 TATCCAGAATGCCTGCAATGAGG + Intronic
1056989649 9:91398916-91398938 AACCCAGGAAGCCCACAGAGAGG - Intergenic
1186747451 X:12584001-12584023 TGCCCAGGTTGCCAGCAAAGTGG - Intronic
1194993355 X:100568806-100568828 TACTTGGGATGCCCTCAAAGGGG - Intergenic
1196725403 X:118890718-118890740 TACTCAGGACGCCCTCAAAGAGG + Intergenic