ID: 1132897536

View in Genome Browser
Species Human (GRCh38)
Location 16:2236198-2236220
Sequence GTAGACGGTCAGCCACATCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132897536_1132897547 2 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897547 16:2236223-2236245 CCCTCCTAGGGGGCTGGCAGGGG 0: 1
1: 0
2: 0
3: 29
4: 333
1132897536_1132897553 20 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897553 16:2236241-2236263 AGGGGCTTCTGGGACGGTTTTGG 0: 1
1: 0
2: 1
3: 12
4: 148
1132897536_1132897542 -4 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897542 16:2236217-2236239 CTACCTCCCTCCTAGGGGGCTGG 0: 1
1: 0
2: 2
3: 19
4: 185
1132897536_1132897555 26 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897555 16:2236247-2236269 TTCTGGGACGGTTTTGGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1132897536_1132897554 21 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897554 16:2236242-2236264 GGGGCTTCTGGGACGGTTTTGGG 0: 1
1: 0
2: 1
3: 17
4: 144
1132897536_1132897550 9 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897550 16:2236230-2236252 AGGGGGCTGGCAGGGGCTTCTGG 0: 1
1: 0
2: 5
3: 65
4: 730
1132897536_1132897538 -10 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897538 16:2236211-2236233 GACCGTCTACCTCCCTCCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1132897536_1132897552 14 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897552 16:2236235-2236257 GCTGGCAGGGGCTTCTGGGACGG 0: 1
1: 0
2: 12
3: 125
4: 993
1132897536_1132897539 -9 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897539 16:2236212-2236234 ACCGTCTACCTCCCTCCTAGGGG 0: 1
1: 0
2: 0
3: 8
4: 75
1132897536_1132897541 -8 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897541 16:2236213-2236235 CCGTCTACCTCCCTCCTAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1132897536_1132897551 10 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897551 16:2236231-2236253 GGGGGCTGGCAGGGGCTTCTGGG 0: 1
1: 1
2: 3
3: 71
4: 621
1132897536_1132897544 0 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897544 16:2236221-2236243 CTCCCTCCTAGGGGGCTGGCAGG 0: 1
1: 0
2: 1
3: 29
4: 248
1132897536_1132897545 1 Left 1132897536 16:2236198-2236220 CCGGGATGTGGCTGACCGTCTAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1132897545 16:2236222-2236244 TCCCTCCTAGGGGGCTGGCAGGG 0: 1
1: 0
2: 1
3: 23
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132897536 Original CRISPR GTAGACGGTCAGCCACATCC CGG (reversed) Exonic
900506676 1:3032785-3032807 GTGGAGGGTCAGCCTCGTCCGGG - Intergenic
903229667 1:21914148-21914170 GTAGACGGTCAGCACCAGCAAGG - Intronic
917060973 1:171038988-171039010 GCTGATGGTCAGCTACATCCGGG - Intronic
922478428 1:225922609-225922631 GAAGAAGGGCAGCCACTTCCTGG - Intronic
1088494870 11:110422678-110422700 GGAGAAGGTCATCCACATACTGG - Intergenic
1103682214 12:122703058-122703080 GTAGAAAGTCAGCCACTGCCAGG + Exonic
1120493255 14:85203410-85203432 GTATAAGGTCACCCAAATCCAGG - Intergenic
1132897536 16:2236198-2236220 GTAGACGGTCAGCCACATCCCGG - Exonic
1137005595 16:35272256-35272278 GTAAAAGGTCATCCACATACTGG + Intergenic
1147249246 17:39143381-39143403 GGAGAGGGAGAGCCACATCCAGG - Intronic
1157726834 18:49970877-49970899 GAATACAGCCAGCCACATCCGGG - Intronic
1158292069 18:55954021-55954043 GCAGAAGGTCATCCACATACAGG - Intergenic
1159604305 18:70459090-70459112 CTATATGGTCAGCCATATCCAGG - Intergenic
1163156524 19:15442730-15442752 GCAGACGGGCAGCCCCATCCCGG - Intronic
1168400485 19:56083474-56083496 GTGGACGGACAGCCTCATTCAGG - Intergenic
932000958 2:67883988-67884010 GTAGACAGCCCTCCACATCCTGG - Intergenic
935332306 2:101985993-101986015 CTAGAAGGACAGCCACACCCAGG - Intergenic
936976794 2:118228838-118228860 GTAGACTGTAAGACACATACTGG - Intergenic
937066847 2:119024008-119024030 GTAGCTGGTCAGCCTCTTCCAGG + Intergenic
941500780 2:166273094-166273116 GCAGAGGGTCAGCCATACCCAGG + Intronic
943731116 2:191304986-191305008 GTCAAAGGTCAGCCACATCTTGG - Intronic
944599114 2:201285192-201285214 GCAGAAAGTCAGCCTCATCCGGG - Exonic
1169715303 20:8609771-8609793 GTAGGTGGTCAGCCACCTACAGG + Intronic
1181260697 22:21595175-21595197 GGAGACGGTAAGCAACAGCCAGG + Intronic
1184401790 22:44278774-44278796 GGCCACAGTCAGCCACATCCAGG + Intronic
953041761 3:39261777-39261799 GTGGAGGGACAGCCACACCCAGG - Intergenic
955250268 3:57274863-57274885 GTAAATGGTCAGCCATAGCCAGG + Intronic
961629030 3:128282872-128282894 GAAGGCCGTCAGCCACAGCCTGG - Intronic
967281279 3:187826535-187826557 GTAGATGGGCAGACACATCCTGG + Intergenic
968837343 4:2974854-2974876 CTAGCTGGGCAGCCACATCCTGG + Intronic
984347799 4:178553456-178553478 GTAGACAGCCAGGCAAATCCTGG - Intergenic
1002630207 5:180569106-180569128 GTAGCCGGAAAGCCACATCTTGG + Exonic
1005754869 6:28917203-28917225 GCAGATGGTCAGTCTCATCCAGG - Intronic
1006797062 6:36738611-36738633 GCAGAGGGCCAGCCACAGCCTGG + Intergenic
1009930340 6:70170172-70170194 GTACACATTCAGCCTCATCCTGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020433795 7:8140578-8140600 TTTGACTGTCAGCCTCATCCTGG + Intronic
1024976767 7:55120597-55120619 CTAGACTGTCAGCTCCATCCGGG + Intronic
1025060175 7:55798700-55798722 CTGGACCGTCAGCCAGATCCTGG + Intronic
1036715956 8:11124279-11124301 GTAGAAACTTAGCCACATCCTGG - Intronic
1037835387 8:22212269-22212291 GTGGCCGGTCAGCCACACCAGGG + Exonic
1043684314 8:83067852-83067874 GGAGAAGGTCATCCACGTCCTGG - Intergenic
1045953974 8:107885386-107885408 GTAGATGGTCATCCACAATCAGG - Intergenic
1058585584 9:106503181-106503203 GTAGACTGTCAGCCCCATGAAGG + Intergenic
1058779617 9:108319672-108319694 GGAGACTGTCTGACACATCCAGG + Intergenic
1061206274 9:129165452-129165474 GTTGACTGTCAGGCACAGCCAGG + Intergenic
1188678700 X:32975384-32975406 GTAGACAGTAAGCCAGCTCCTGG + Intronic
1188837657 X:34978326-34978348 GGAGACCATCAGCCACATGCTGG + Intergenic
1190829533 X:54047516-54047538 GTAGACTGTCAGCTGCATGCAGG - Intronic