ID: 1132898838

View in Genome Browser
Species Human (GRCh38)
Location 16:2242580-2242602
Sequence CTCTGCAGATGTAATTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 2, 2: 10, 3: 41, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132898832_1132898838 27 Left 1132898832 16:2242530-2242552 CCCTAACCACTGCTCTGGAACTT 0: 1
1: 0
2: 3
3: 17
4: 156
Right 1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG 0: 1
1: 2
2: 10
3: 41
4: 219
1132898837_1132898838 -6 Left 1132898837 16:2242563-2242585 CCTTATTTGGAAAGAGTCTCTGC 0: 1
1: 1
2: 30
3: 78
4: 358
Right 1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG 0: 1
1: 2
2: 10
3: 41
4: 219
1132898835_1132898838 21 Left 1132898835 16:2242536-2242558 CCACTGCTCTGGAACTTGGAAGT 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG 0: 1
1: 2
2: 10
3: 41
4: 219
1132898833_1132898838 26 Left 1132898833 16:2242531-2242553 CCTAACCACTGCTCTGGAACTTG 0: 1
1: 0
2: 3
3: 18
4: 192
Right 1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG 0: 1
1: 2
2: 10
3: 41
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132898838 Original CRISPR CTCTGCAGATGTAATTAAGT TGG Intronic
900010217 1:100117-100139 CCCTGCAGATGAAATTATATGGG + Intergenic
900026324 1:276680-276702 CCCTGCAGATGAAATTATATGGG + Intergenic
900036110 1:410516-410538 CCCTGCAGATGAAATTATATGGG + Intergenic
900057734 1:646268-646290 CCCTGCAGATGAAATTATATGGG + Intergenic
900502113 1:3011460-3011482 CTTTGCAGATGTAACAAGGTAGG - Intergenic
900973559 1:6004702-6004724 TTTTGCAGATGTAATTAAGGTGG - Intronic
909545772 1:76844841-76844863 CTTTAAAGAGGTAATTAAGTGGG - Intergenic
910769952 1:90821090-90821112 CTCTTTGGATGTAATTAACTAGG - Intergenic
910882758 1:91937319-91937341 CTCTGCAGATACAATTAAAATGG + Intergenic
912116018 1:106409209-106409231 CTCAGTAGATCTAATTATGTAGG + Intergenic
912184677 1:107261012-107261034 CTCTTCAGATGTACTTACCTGGG - Intronic
917505431 1:175622989-175623011 CTTTGCAGATGTAATTAGGATGG - Intronic
919074029 1:192792263-192792285 CTCTTGAGAAGTAAGTAAGTGGG - Intergenic
920075450 1:203333092-203333114 CTTTGCAGTTATAATTAATTAGG + Intergenic
920268585 1:204745534-204745556 CTCTGAAGATGAAATAAGGTGGG + Intergenic
920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG + Intergenic
921544215 1:216454797-216454819 CTTTGCAGATATAATTCATTTGG - Intergenic
922258653 1:223916101-223916123 CCCTGCAGATGAAATTATATGGG + Intergenic
922520683 1:226248895-226248917 CTCTGTAGAAGTAATCTAGTTGG - Intronic
924339844 1:243018861-243018883 CCCTGCAGATGAAATTATATGGG + Intergenic
1063751798 10:8957423-8957445 GTTTGCAGATGTAATTAAGATGG - Intergenic
1065778397 10:29143656-29143678 CTCTGCAGATTGCATCAAGTGGG + Intergenic
1067138097 10:43629553-43629575 CTTTGCAGATGTAATTAGTTAGG + Intergenic
1068970029 10:62949199-62949221 CTCTTCTGCTGGAATTAAGTGGG - Intergenic
1069373683 10:67772463-67772485 CTGTGAAGATATCATTAAGTGGG + Intergenic
1071351085 10:84745881-84745903 CTTTGCTGATGTGATTAAGTTGG - Intergenic
1071776035 10:88789147-88789169 CTTTGCATATGTGATTAAGTTGG + Intergenic
1074887839 10:117708516-117708538 CTCTGCAGATGTGAGGAATTAGG + Intergenic
1078360161 11:10661782-10661804 CTTTGCAGATATGATTAAATTGG - Intronic
1078712497 11:13807924-13807946 CTTTGCAGATGTAAGTAATTAGG - Intergenic
1078899177 11:15625528-15625550 CTCTGCAGGTTTAAAGAAGTGGG + Intergenic
1081518592 11:43859562-43859584 GTTTGCAGATGTGATTAAATTGG + Intergenic
1082177615 11:49079421-49079443 CTTTGCAGATGTAACTACCTTGG - Intergenic
1084405156 11:68967830-68967852 CTTTGCAGATGTACTTAGCTAGG - Intergenic
1084905036 11:72339131-72339153 ATCTGCAGATGTAATTAAGGTGG + Intronic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1086408961 11:86524837-86524859 CTCATCAGATGCAATTAAGCAGG + Intronic
1086453661 11:86941155-86941177 ATCTGCTGATGTAAATATGTAGG - Intronic
1086675691 11:89604462-89604484 CTCTGCAGATGACATAAAGCAGG - Intergenic
1086688106 11:89756453-89756475 CTTTGCAGATGTAACTACCTTGG + Intergenic
1086717745 11:90083446-90083468 CTTTGCAGATGTAACTACCTTGG - Intergenic
1087516959 11:99176067-99176089 TTTAGCAGATGTAATTAAGTGGG - Intronic
1088071580 11:105793157-105793179 TTCTGGAGATGTAAATAAGATGG + Intronic
1090201439 11:124860649-124860671 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1090644977 11:128760101-128760123 CTCTCCAGATGTAATTCTGATGG + Intronic
1091493482 12:952526-952548 CTTTGTAGATGTAATCAAGTAGG + Intronic
1092767116 12:11862708-11862730 CCTTGCAGATGTAATTAGTTAGG - Intronic
1093538015 12:20246278-20246300 ATCTGAAGATGTAATGCAGTTGG + Intergenic
1098444436 12:70551713-70551735 CTCTGCAGAAGTAATAATGTTGG + Intronic
1100689115 12:97019858-97019880 AGCTGCAAATGTAATTATGTAGG + Intergenic
1104357822 12:128103604-128103626 CTCTGAAGATGTACGTGAGTGGG + Intergenic
1105846978 13:24301787-24301809 CTGTGCAGAGGTAATTTAGAAGG - Intronic
1107804456 13:44141365-44141387 CTCTGTAAAGGTATTTAAGTTGG + Intergenic
1108242837 13:48484891-48484913 CTCTGTTGATGTAATAAAGGGGG + Intergenic
1108856623 13:54800466-54800488 CTTAGAAGATGTGATTAAGTCGG + Intergenic
1110355485 13:74562107-74562129 AATTGCAGATGTAATTAATTGGG - Intergenic
1110658678 13:78032292-78032314 CTGGGCAGATATAATTAAGCAGG + Intergenic
1112569413 13:100580259-100580281 CTTTGCACATGTGATTAATTAGG + Intronic
1113093156 13:106636012-106636034 CTTTGCAGATGTAAATAAGATGG - Intergenic
1115762939 14:36593837-36593859 CTTTGAAGATGTAATTAGTTTGG - Intergenic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1117873471 14:60224725-60224747 CTTTGCAAATGTAATTAGTTAGG + Intergenic
1118447393 14:65864078-65864100 CTTTGCAGATGTGATTTAGATGG - Intergenic
1119444834 14:74654435-74654457 CTCTGGAGATGTTCTAAAGTGGG - Intronic
1119982858 14:79101774-79101796 CTTTGCAGATGTGATTAAAATGG + Intronic
1120059715 14:79968071-79968093 CTCTCCAGATGGCAATAAGTTGG - Intergenic
1121941380 14:98074071-98074093 CTCTGCTGAACTTATTAAGTTGG + Intergenic
1202940572 14_KI270725v1_random:141840-141862 CTCTACAAATGTAATTCATTTGG - Intergenic
1124103440 15:26716601-26716623 CTAAGGAGATGTAAGTAAGTGGG - Intronic
1124184343 15:27510308-27510330 TTCTGCAGATGTAATGATGTTGG + Intronic
1125213676 15:37244398-37244420 CACTGCAGATATAATTAACCTGG + Intergenic
1126309784 15:47302516-47302538 CTTTGCAGATGTGATTAAGTAGG + Intronic
1127123211 15:55788833-55788855 CTCTGAAGAGGTAATTCAGCAGG + Intergenic
1127720422 15:61693754-61693776 CATTGCAGTTGTAATTAAGAAGG + Intergenic
1130015410 15:80182268-80182290 TTCTGGAGATGTGATTAAGTTGG - Intronic
1130798930 15:87240712-87240734 CTTTGCAGAGGTAATCAACTTGG + Intergenic
1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG + Intronic
1135138690 16:19903619-19903641 CTTTGCAGATGTGATTAAGTTGG + Intergenic
1136298311 16:29316394-29316416 CTCTGCAGATGTGATTCCTTAGG - Intergenic
1137942352 16:52700776-52700798 CTCTGCAGATGTATTTTCTTTGG - Intergenic
1138737542 16:59268143-59268165 ATCTCCAAATGCAATTAAGTGGG - Intergenic
1139077389 16:63468814-63468836 CTTTGTAGATTTATTTAAGTAGG + Intergenic
1140155037 16:72415672-72415694 CTCTGAACATGTAATTAAGGTGG + Intergenic
1141198475 16:81879188-81879210 CCCTCCAGATGTAAATAAGCTGG + Intronic
1141315885 16:82962111-82962133 CTTTGCAGAGGTAATTAAGTTGG + Intronic
1142059968 16:88022899-88022921 CTCTGCAGATGTGATTCATTAGG - Intronic
1142454122 16:90206803-90206825 CCCTGCAGATGAAATTATATGGG - Intergenic
1143788316 17:9273399-9273421 CTCTGCAGGTTTAACTAAGATGG + Intronic
1143972687 17:10806832-10806854 CTTTGCAGATCTAATTAGTTAGG - Intergenic
1146949988 17:36899345-36899367 CTGTGGAGATGGAATTCAGTAGG + Intergenic
1147305550 17:39561765-39561787 TTCTGCAGCTGTAAGTGAGTGGG - Intronic
1149208593 17:54277783-54277805 TTCTGCAGCTGTATTTCAGTGGG + Intergenic
1149239041 17:54627036-54627058 CTATGCTGATGTATTTAATTTGG - Intergenic
1150476983 17:65483122-65483144 CTTTGCAGATGTAATTAGTTAGG - Intergenic
1151152079 17:72097054-72097076 TTCTGCATTTGTAAATAAGTGGG - Intergenic
1151193920 17:72418477-72418499 CTTTGCACATGTAATTAGCTAGG - Intergenic
1151397351 17:73832427-73832449 CTTTGCAGATGTAAATAATTAGG - Intergenic
1152307250 17:79528560-79528582 CTTTGCAGATGTAATTAAGTTGG + Intergenic
1152342453 17:79732753-79732775 CTTTGCAGATGTGATTAGCTAGG - Intronic
1153831434 18:8927052-8927074 TTATACAGATTTAATTAAGTTGG - Intergenic
1156163145 18:34384604-34384626 CTCTCCAACTGAAATTAAGTTGG + Intergenic
1156189956 18:34707326-34707348 TTCTTCATATGAAATTAAGTGGG + Intronic
1156871006 18:41945009-41945031 CATTGCAGATGTAATTAGTTAGG + Intergenic
1157158702 18:45292314-45292336 GTCTGTATATGTAACTAAGTAGG + Intronic
1157366225 18:47066956-47066978 CTCTACAGCTGTAATAAACTTGG - Intronic
1157504463 18:48216880-48216902 CACTGCAGATGTAATTAATTAGG + Intronic
1158300816 18:56050546-56050568 CTCAGACGATGTAATTAATTAGG - Intergenic
1158944745 18:62438421-62438443 CTTTGCAGATGTAATTAAGGGGG + Intergenic
1158958848 18:62570443-62570465 CACTGCATATGAAGTTAAGTAGG + Intronic
1159135272 18:64330108-64330130 CTTTGCACATGTAATTAATTAGG - Intergenic
1159236179 18:65676029-65676051 CACTGCACATGTGATTAAATTGG - Intergenic
1160761839 19:789407-789429 TTCTGCAGATGTAATTAGTTAGG - Intergenic
1163403346 19:17107819-17107841 CTTTGCAAATGCAATTAGGTAGG - Intronic
1163689618 19:18731491-18731513 TTCTGCAGATGTAATTAGTGCGG - Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164298282 19:23936076-23936098 CCCTGCAAATGTAATGAATTTGG + Intronic
1165565823 19:36726791-36726813 AACTGCAGATGGAATTACGTAGG - Intronic
925196215 2:1928268-1928290 CTGTGCAGAGGAAATGAAGTTGG + Intronic
925389966 2:3487913-3487935 CTTTGCAGATGTAATTAAATAGG - Intergenic
926281664 2:11453274-11453296 CTCTGGAGTTGTAATTCGGTAGG - Intronic
931141651 2:59465429-59465451 CACTACACATGTAAATAAGTAGG + Intergenic
932799057 2:74723345-74723367 CACTGCAGATGTAATTAGTTAGG - Intergenic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934057482 2:88263816-88263838 CTTTGCAGGTGTAATTAAGGTGG - Intergenic
934582313 2:95453626-95453648 CTTTGCAGATGTAATTACCTTGG + Intergenic
934597137 2:95623088-95623110 CTTTGCAGATGTAATTACCTTGG - Intergenic
934842743 2:97639912-97639934 CTTTGCAGATGTAATTACCTTGG + Intergenic
934925187 2:98377284-98377306 CTCAGAAGATGAAATTCAGTAGG + Intronic
935715969 2:105939266-105939288 CTCTGAAGATGAACTTAAGGGGG + Intergenic
936236641 2:110747927-110747949 CTCTGCAGATGCCAATAAGAGGG - Intronic
936706531 2:115081495-115081517 CTCTGCAGATATCTTTTAGTTGG + Intronic
938972123 2:136442290-136442312 CTCTGCAGATCCCATTATGTGGG + Intergenic
941240287 2:163027689-163027711 CATTGCAGATGTAATTAGTTTGG + Intergenic
943551513 2:189346017-189346039 CTATGCTGATGAACTTAAGTTGG - Intergenic
943862936 2:192892073-192892095 CTTTGCAGATGTCATTAAGATGG - Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
948306385 2:236950274-236950296 CTCTGCAGATGAAATAAAAATGG + Intergenic
948790882 2:240376284-240376306 CTCTGCCCATGTAATAAAGATGG - Intergenic
949085574 2:242151465-242151487 CCCTGCAGATGAAATTATATGGG - Intergenic
1168957297 20:1843263-1843285 CTGTGCAGATGTAAATATATGGG + Intergenic
1169023322 20:2347030-2347052 CTCAGAAGATGTAATCAAGGCGG + Intergenic
1170402384 20:16002371-16002393 CGATGCTGATGTAATTAAGTTGG + Intronic
1170758822 20:19231042-19231064 TTCTGCAGAGATAATTACGTGGG - Intronic
1171804617 20:29663977-29663999 CTCTACTAATGTAATTAATTTGG + Intergenic
1172333098 20:34089966-34089988 CTTTGTAGATGTATTTAAGAAGG - Intronic
1173076937 20:39828251-39828273 CATTGCAGATGTAATTAGTTAGG + Intergenic
1174412523 20:50345247-50345269 GTCTGCTGTTGTCATTAAGTTGG + Intergenic
1174732720 20:52933560-52933582 CTCTTCATATGTAATTTATTTGG - Intergenic
1176313376 21:5217795-5217817 CTCTGGAGATGTATTTATTTAGG - Intergenic
1176313910 21:5223896-5223918 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1176582574 21:8545104-8545126 CTCTACAAATGTAATTCATTTGG + Intergenic
1176957798 21:15126374-15126396 GTCTGCAGAAGAAATTAAGTGGG - Intergenic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1178906255 21:36639470-36639492 CTTTGCAGATGTAACTAAGATGG - Intergenic
1179015623 21:37592520-37592542 CTTTGCAAATGTAATTAGTTGGG - Intergenic
1180265405 22:10522152-10522174 CTCTACAAATGTAATTCATTTGG + Intergenic
1180391729 22:12290013-12290035 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG + Intergenic
1180781380 22:18521816-18521838 CACTGCAGGTGTGATTAAGATGG - Intergenic
1181238264 22:21461159-21461181 CACTGCAGGTGTGATTAAGATGG - Intergenic
1181713187 22:24704571-24704593 CTTTGCTGATGGAATTAAGGTGG - Intergenic
1181992523 22:26848164-26848186 GGTTGCAGATGTTATTAAGTAGG + Intergenic
1182242590 22:28928382-28928404 CTCAGCAGATGTATATATGTTGG - Intronic
1182251299 22:29003092-29003114 CTCTGCAGATATAATGCAATTGG + Intronic
1182619064 22:31608455-31608477 CACTGCAGATGTAATTGGTTAGG - Intronic
1184524129 22:45011631-45011653 CTCTGTTGATTTAATTACGTAGG + Intergenic
949606709 3:5661535-5661557 CTCAGAATATCTAATTAAGTAGG - Intergenic
949724097 3:7023752-7023774 CTTTACAGAGGTAATTAAGATGG - Intronic
950874251 3:16255804-16255826 TTCTGCAGGTGTAAGTAATTAGG - Intergenic
951866556 3:27315139-27315161 CAATACAGATGTAATTAAGCAGG - Intronic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953775528 3:45813350-45813372 CTTTGCAGATGTCATTAAGTTGG + Intergenic
957271580 3:78037133-78037155 CTTTGAAGATGGCATTAAGTAGG - Intergenic
958901193 3:99888158-99888180 CTATGAAGTTGTAATTAAATAGG + Intronic
962428600 3:135298285-135298307 CATTGCAGATGTAATTAGTTAGG - Intergenic
963223921 3:142841429-142841451 ATCTGCAAGTATAATTAAGTTGG + Intronic
965137703 3:164794220-164794242 CTTTGCAGATTTAAATAAATGGG + Intergenic
965437871 3:168674902-168674924 CATTGCAGATGTAATTAGTTAGG - Intergenic
966088972 3:176107420-176107442 CTTTGCAGATGTAATTTAAGCGG + Intergenic
968147895 3:196314897-196314919 CTCTACAGATGTAGTTTGGTAGG + Intronic
968750234 4:2385130-2385152 CTCTGCAGTTGTGATGAGGTGGG - Intronic
968781938 4:2589275-2589297 TTCTACAGATGTAAATAAGATGG - Intronic
970038381 4:11767200-11767222 CACTGAAGATATAATTAGGTAGG - Intergenic
970138175 4:12949518-12949540 GTCTGCAGATATATTTATGTTGG - Intergenic
972052067 4:34748990-34749012 CTTTGTAGATGTGATTAAATTGG - Intergenic
973122158 4:46534954-46534976 TGTTGCAGATATAATTAAGTAGG + Intergenic
973288721 4:48448582-48448604 ATCTGAAGATATAATTAAATAGG + Intergenic
978379203 4:108109157-108109179 CTGTGCAGAACTAATTAAATTGG + Intronic
978931808 4:114323253-114323275 CTCTGCAAATGGATTTAACTAGG - Intergenic
979016359 4:115439443-115439465 CTTTGCAGCTGTAATTATGTAGG + Intergenic
979263012 4:118669718-118669740 CCCTGCAGATGAAATTATATGGG - Intergenic
981963500 4:150572464-150572486 TTCTGCAAAGATAATTAAGTTGG - Intronic
982841587 4:160194588-160194610 CTTTGCAAATGTTAGTAAGTAGG - Intergenic
982920922 4:161273959-161273981 CTCTGTTGATGTTATTAAGCTGG - Intergenic
983045732 4:162984617-162984639 ATTTACAGATGTAATTAAGATGG + Intergenic
985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG + Intronic
987038487 5:14040425-14040447 CACTGCAGCTGAAATTAAGGTGG - Intergenic
987336059 5:16898840-16898862 ATCTAGAGATGTAATTCAGTAGG + Intronic
987435865 5:17893685-17893707 CTCTGTTGATGTGATTAACTTGG - Intergenic
989535068 5:42553639-42553661 TTTTGCAGATGTAATTAAGATGG - Intronic
994225070 5:97242283-97242305 CACTGTAGAAGCAATTAAGTTGG - Intergenic
994227168 5:97265918-97265940 CTTTGCAGTTGTACTTAAGATGG - Intergenic
995689510 5:114808611-114808633 CTCTGCTGATGAAAGTAAATGGG + Intergenic
995923995 5:117347183-117347205 CTCTGCTTCTGTAATTAAATAGG - Intergenic
996140203 5:119897716-119897738 GTCTGCAAATATAATTAAGGTGG + Intergenic
996392767 5:122980262-122980284 CTCTGCAGATCTACTTTACTGGG + Intronic
996731762 5:126723962-126723984 CTCTGCAAATGAACTTAACTTGG - Intergenic
996960774 5:129246575-129246597 CTTTGCAGATGTAATCAAATTGG + Intergenic
997162737 5:131625969-131625991 TTTTGGAGATGTAATTGAGTGGG - Intronic
997473589 5:134130164-134130186 CTCTGCAGATATACTCCAGTAGG - Intronic
997857455 5:137384865-137384887 CTTCGCAGATGTAATTAAGTTGG - Intronic
999104462 5:149058631-149058653 CTTAGCAGATGTATGTAAGTGGG + Intronic
1000238508 5:159386877-159386899 TTCTGCAGATGTATATATGTTGG + Intergenic
1000830627 5:166096899-166096921 TTCTGCATCTGTAATTAATTCGG + Intergenic
1000888263 5:166773366-166773388 CCATGTAGATGTAATTAAATAGG + Intergenic
1001188898 5:169607597-169607619 CTTTGCAGATATAATTAGTTAGG - Intergenic
1002737711 5:181408348-181408370 CCCTGCAGATGAAATTATATGGG - Intergenic
1003034346 6:2630062-2630084 CTTTGCAGACATAATTAAGTTGG + Intronic
1003423569 6:5980329-5980351 CTCTGGAGATGTCATTCAGCAGG + Intergenic
1004285958 6:14321007-14321029 CTCTGCAGATGTAAAAAATAAGG - Intergenic
1004563133 6:16770449-16770471 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1005196962 6:23298368-23298390 CTCAGCAGAAGTAATTAGGCGGG - Intergenic
1008840151 6:55893168-55893190 ATTTGCAGATGTTATTAATTAGG - Intergenic
1011613030 6:89171868-89171890 CTCTGCACATGTCATTAACTGGG + Intergenic
1014068963 6:117159351-117159373 CTTTGCAGATGTAATTAATTAGG - Intergenic
1015402494 6:132801901-132801923 CTGTGCAGATGTGACTAAATTGG - Intergenic
1016327106 6:142915261-142915283 CCTTGCAGATGTAATTAGTTAGG + Intronic
1016769149 6:147829087-147829109 CTCTGAAGTTGCAAGTAAGTTGG - Intergenic
1016801919 6:148177689-148177711 CTCTGCAGAAGGGATGAAGTTGG + Intergenic
1019228652 6:170537718-170537740 CACTGCAGATGTAAAACAGTTGG + Intronic
1019242809 6:170683905-170683927 CCCTGCAGATGAAATTATATGGG - Intergenic
1020988859 7:15170639-15170661 CTCTGCTAATGTAATTAAATTGG - Intergenic
1021662226 7:22931084-22931106 CTCTGCAAATGAAATTAGTTAGG + Intergenic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1025769472 7:64490670-64490692 CTCTTCAGATTTGATCAAGTAGG + Intergenic
1027771832 7:82416718-82416740 CTTTGCAGATGTAACTAGTTAGG - Intronic
1031527964 7:122844231-122844253 CAATCCAGATGTAACTAAGTTGG + Intronic
1032527571 7:132591155-132591177 CTCTGCAGATGCAATCAACATGG + Intronic
1033016102 7:137673149-137673171 TGTTGCAGATGTAATTAATTAGG - Intronic
1033032424 7:137840190-137840212 TTCTGAAGATTTTATTAAGTGGG + Intronic
1033204386 7:139405106-139405128 CTTTGCTGATGTGTTTAAGTGGG + Intronic
1033473986 7:141673088-141673110 CTCTGCAAAGGCAATGAAGTGGG + Intronic
1033916675 7:146334710-146334732 CTCTGCAAGTGTAATGAAGAGGG + Intronic
1035505311 8:124250-124272 CCCTGCAGATGAAATTATATGGG + Intergenic
1038464354 8:27747194-27747216 CTTTGCAGATGTCATTAGTTAGG + Intronic
1038666425 8:29541592-29541614 CTTTGCTGAAGTAATTAAGATGG + Intergenic
1038936921 8:32262349-32262371 TTCTGCAAATGCAAATAAGTTGG - Intronic
1041223439 8:55674480-55674502 CTTTGCAGATGTATTTGAGTAGG + Intergenic
1042775765 8:72429262-72429284 CATTGCAGATGTAATTAGATAGG + Intergenic
1043245178 8:77990378-77990400 TGTTGCAGATGTAATTAGGTAGG + Intergenic
1043624222 8:82234626-82234648 CTTTTAACATGTAATTAAGTAGG - Intergenic
1047163256 8:122405898-122405920 GTCTGCAGATGTGATAAATTTGG - Intergenic
1048003056 8:130395367-130395389 CTTTGCAGATATAATTAAGGTGG + Intronic
1049151527 8:141038162-141038184 CTCTGCAATTGGAATTAATTAGG - Intergenic
1056502298 9:87221886-87221908 CTTTGAAGATGTAATTAATTAGG - Intergenic
1057262797 9:93594815-93594837 GTCTGAAGATGTTATTAGGTTGG + Intronic
1203603000 Un_KI270748v1:33129-33151 CCCTGCAGATGAAATTATATGGG - Intergenic
1203612592 Un_KI270749v1:23116-23138 CTCTACAAATGTAATTCATTTGG + Intergenic
1185527957 X:794187-794209 TTCTGCAGTTGGAATTAAGTGGG + Intergenic
1186794123 X:13027879-13027901 CTCAGCAGAATTAATTAAGTAGG - Intergenic
1186961313 X:14739598-14739620 CTCTGAAGATGTTATTAATGCGG - Intergenic
1189868210 X:45353510-45353532 CACTGCAGATGGAATTAGTTAGG + Intergenic
1191911858 X:66160241-66160263 GTCTGCAGATGCAAGTAAGCTGG + Intergenic
1194044008 X:88979317-88979339 ATTTGCACATGTAATTATGTAGG + Intergenic
1194222746 X:91215555-91215577 CTCTTCAGATGTACTGAATTAGG + Intergenic
1197179562 X:123519850-123519872 CTCTCACGAGGTAATTAAGTAGG + Intergenic
1198558127 X:137818092-137818114 CTTTGCAGATGTTATTAAATTGG + Intergenic
1199372523 X:147067852-147067874 CTCTACAGGTTTAATGAAGTAGG + Intergenic
1200559224 Y:4679013-4679035 CTCTTCAGATGTACTGAATTAGG + Intergenic
1202385075 Y:24318187-24318209 CCCTGCAGATGAAATTATATAGG - Intergenic
1202485710 Y:25351941-25351963 CCCTGCAGATGAAATTATATAGG + Intergenic