ID: 1132898961

View in Genome Browser
Species Human (GRCh38)
Location 16:2243190-2243212
Sequence GGTGCCCGATGGTGTTCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132898952_1132898961 6 Left 1132898952 16:2243161-2243183 CCCCAGCTGCAGGGCACGCTCCG 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1132898961 16:2243190-2243212 GGTGCCCGATGGTGTTCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1132898947_1132898961 28 Left 1132898947 16:2243139-2243161 CCTCCGCCGGCGGGAAGAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1132898961 16:2243190-2243212 GGTGCCCGATGGTGTTCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1132898953_1132898961 5 Left 1132898953 16:2243162-2243184 CCCAGCTGCAGGGCACGCTCCGC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1132898961 16:2243190-2243212 GGTGCCCGATGGTGTTCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1132898948_1132898961 25 Left 1132898948 16:2243142-2243164 CCGCCGGCGGGAAGAGCAGCCCC 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1132898961 16:2243190-2243212 GGTGCCCGATGGTGTTCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1132898949_1132898961 22 Left 1132898949 16:2243145-2243167 CCGGCGGGAAGAGCAGCCCCAGC 0: 1
1: 0
2: 4
3: 34
4: 315
Right 1132898961 16:2243190-2243212 GGTGCCCGATGGTGTTCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1132898954_1132898961 4 Left 1132898954 16:2243163-2243185 CCAGCTGCAGGGCACGCTCCGCC 0: 1
1: 0
2: 3
3: 14
4: 210
Right 1132898961 16:2243190-2243212 GGTGCCCGATGGTGTTCTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132898961 Original CRISPR GGTGCCCGATGGTGTTCTCC AGG Exonic
902319885 1:15654283-15654305 GGTGGCAGATGGAGTTTTCCAGG + Intronic
1070588409 10:77783308-77783330 GGGACCCAAAGGTGTTCTCCTGG + Intergenic
1071471153 10:85984802-85984824 AGTGCCCCATGGTTTGCTCCTGG - Intronic
1074336622 10:112582834-112582856 GGTGCACAGTGGTGGTCTCCAGG - Intronic
1076236073 10:128864670-128864692 GGTGCCTCATGGTGCTCCCCTGG + Intergenic
1084587483 11:70071043-70071065 GGTGCCCCTGGGTGTCCTCCTGG + Intergenic
1099634714 12:85199195-85199217 TGTGCCAGATGGTGTTTTCTAGG + Intronic
1102207027 12:111097788-111097810 GGTGCCCAATGCTGTGCCCCAGG - Intronic
1111668400 13:91298799-91298821 GGTTCCCCATGCTGTTCTCCTGG + Intergenic
1116356271 14:43935871-43935893 GTTTCCCCATGGTGTTCTCATGG - Intergenic
1121349431 14:93161650-93161672 GGTGCTGAATGGTGTCCTCCAGG + Intergenic
1124348316 15:28937114-28937136 TGTGCCCGGTGGTGGTCTCGAGG + Intronic
1132898961 16:2243190-2243212 GGTGCCCGATGGTGTTCTCCAGG + Exonic
1142016082 16:87748444-87748466 GCTGCCTGGTGTTGTTCTCCAGG - Intronic
1144640313 17:16933220-16933242 GGTCCCCCTGGGTGTTCTCCAGG - Intronic
1144833764 17:18145910-18145932 AGTTCCCGAAGATGTTCTCCCGG - Exonic
1146266575 17:31457210-31457232 GGTTCTCGACTGTGTTCTCCTGG + Intronic
1146565109 17:33906202-33906224 GGAGACCTATGGTCTTCTCCGGG + Intronic
1149487106 17:57051146-57051168 GGTGCCTGCTGATGTTTTCCGGG - Intergenic
1153577531 18:6537348-6537370 GGTCCCCCATGCAGTTCTCCTGG + Intronic
1158515102 18:58124192-58124214 AGTGCCAGAGGGTGTTCCCCGGG + Intronic
1160159336 18:76459512-76459534 GGTGCCCGATGGGGTGCACACGG - Intronic
1160823111 19:1067395-1067417 GGGGCCCCATCATGTTCTCCAGG + Intronic
1164380866 19:27736111-27736133 GGTGACCGAAGGTGTTCTAATGG - Intergenic
932696240 2:73959262-73959284 GGTCCCCCATGCTGTTCTCATGG - Intergenic
936062789 2:109306560-109306582 AGTGGCTGGTGGTGTTCTCCAGG + Intronic
939833689 2:147102651-147102673 GGTGCCAGATGTGGTTTTCCAGG - Intergenic
1173006374 20:39142677-39142699 AGGGCCCGCTGGCGTTCTCCCGG - Intergenic
1181416791 22:22765526-22765548 TGTGCCAGATGGGGATCTCCTGG - Intronic
949357045 3:3192146-3192168 GGTGACTGCTGGTGTTTTCCTGG - Intergenic
954791129 3:53134408-53134430 GGTGCTCAATGGTGATCACCAGG - Intergenic
961037444 3:123652519-123652541 GGTGCCCTCTAGTGTTCTCTGGG - Intronic
969710075 4:8837764-8837786 GGTGCCGGCTGGTGATCTCCAGG - Intergenic
970950726 4:21752443-21752465 TGTGCCCCATGCTGTTCTCCTGG - Intronic
971191596 4:24433870-24433892 AGGACCAGATGGTGTTCTCCTGG + Intergenic
976149751 4:82079973-82079995 GGTCCCCCATGGTATTCCCCAGG + Intergenic
985671402 5:1208804-1208826 GCTGCCCGATGGCGAACTCCAGG - Exonic
1001680159 5:173550822-173550844 GTTGCCCTCTGGTGTTGTCCAGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1012366622 6:98448711-98448733 GCTTCCCGAGGGTTTTCTCCAGG - Intergenic
1013283798 6:108663448-108663470 TGTGCCGGATGGAGTTCTGCAGG - Exonic
1021629000 7:22625132-22625154 GGTGTCCCATTGTGTTGTCCAGG + Intronic
1022653567 7:32298522-32298544 GGGGCCGGAGGGTGCTCTCCGGG - Intronic
1023668513 7:42551847-42551869 GGTGCCCTATGTTTTTCTCCTGG - Intergenic
1036297826 8:7550813-7550835 GGTGCCCCCTGGTTTTCCCCAGG + Intergenic
1036299130 8:7558461-7558483 GGTGCCCCCTGGTTTTCCCCAGG + Intergenic
1036300435 8:7566111-7566133 GGTGCCCCCTGGTTTTCCCCAGG + Intergenic
1036324747 8:7770205-7770227 GGTGCCCCCTGGTTTTCCCCAGG - Intergenic
1050319680 9:4438681-4438703 GGTTCCCCATGCTGTTCTCATGG + Intergenic
1053242530 9:36507690-36507712 AGTGCCAGATGTTGTTCTGCTGG + Intergenic
1062059378 9:134486729-134486751 AGTGCCAGATGGCCTTCTCCAGG + Intergenic
1192153003 X:68723691-68723713 GGTGCTGCATCGTGTTCTCCGGG + Exonic
1199330641 X:146554172-146554194 GGTCGCCAATGGTGTTCTCATGG + Intergenic