ID: 1132903065

View in Genome Browser
Species Human (GRCh38)
Location 16:2268686-2268708
Sequence CGCCTGCCGCGCCCACCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132903065_1132903076 24 Left 1132903065 16:2268686-2268708 CCACCGGGTGGGCGCGGCAGGCG 0: 1
1: 1
2: 0
3: 10
4: 161
Right 1132903076 16:2268733-2268755 GAGCTTGAGAGTGGGAGATGGGG 0: 1
1: 0
2: 2
3: 43
4: 454
1132903065_1132903073 16 Left 1132903065 16:2268686-2268708 CCACCGGGTGGGCGCGGCAGGCG 0: 1
1: 1
2: 0
3: 10
4: 161
Right 1132903073 16:2268725-2268747 AGAGCGACGAGCTTGAGAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1132903065_1132903075 23 Left 1132903065 16:2268686-2268708 CCACCGGGTGGGCGCGGCAGGCG 0: 1
1: 1
2: 0
3: 10
4: 161
Right 1132903075 16:2268732-2268754 CGAGCTTGAGAGTGGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 156
1132903065_1132903074 22 Left 1132903065 16:2268686-2268708 CCACCGGGTGGGCGCGGCAGGCG 0: 1
1: 1
2: 0
3: 10
4: 161
Right 1132903074 16:2268731-2268753 ACGAGCTTGAGAGTGGGAGATGG 0: 1
1: 0
2: 0
3: 14
4: 252
1132903065_1132903071 -8 Left 1132903065 16:2268686-2268708 CCACCGGGTGGGCGCGGCAGGCG 0: 1
1: 1
2: 0
3: 10
4: 161
Right 1132903071 16:2268701-2268723 GGCAGGCGGGCTGTGCGGGCAGG 0: 1
1: 0
2: 5
3: 76
4: 544
1132903065_1132903072 15 Left 1132903065 16:2268686-2268708 CCACCGGGTGGGCGCGGCAGGCG 0: 1
1: 1
2: 0
3: 10
4: 161
Right 1132903072 16:2268724-2268746 AAGAGCGACGAGCTTGAGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132903065 Original CRISPR CGCCTGCCGCGCCCACCCGG TGG (reversed) Intergenic
900243978 1:1629375-1629397 CGCCTGCCGCTCCCTGCAGGGGG - Exonic
900787099 1:4655814-4655836 CGCCCGCCGCGCCCAGCGGCCGG - Intronic
902585658 1:17437772-17437794 CGCCGGCCGCCCCCTCCCCGCGG + Intronic
903090917 1:20916200-20916222 CGCCTGCCTCGGCCTCCCAGAGG - Intronic
903573207 1:24321706-24321728 CTCCATCCGCGCCCGCCCGGTGG + Intronic
904199744 1:28812116-28812138 CGCCCGCCGCGCGCACCACGTGG - Intergenic
909739146 1:79006729-79006751 ACCCTGCCGCGCCCGCCCAGCGG - Intergenic
912804491 1:112744362-112744384 CGAACGCCGCGCCCACTCGGCGG - Intergenic
914845808 1:151282871-151282893 CTCCCGCCGCGCACTCCCGGAGG - Intronic
915552253 1:156642047-156642069 CCCCTGCCCCGCCCTCCCCGGGG - Exonic
918174366 1:182029977-182029999 CGCCCGCCCCGCCCCCCGGGGGG - Intergenic
919486865 1:198157121-198157143 CTCCCGCCGCGCCGCCCCGGCGG - Exonic
921671097 1:217925038-217925060 CGCCGGCCGCGGGCACACGGAGG - Intergenic
923221078 1:231893711-231893733 CGTATGCCACGCCCACCCAGAGG - Intronic
924634710 1:245774945-245774967 CGCCAGCCTCGGCCTCCCGGAGG + Intronic
924692149 1:246362705-246362727 CGCCAGCCTCGGCCTCCCGGAGG + Intronic
924788289 1:247220233-247220255 CGCCAGCCTCGGCCTCCCGGAGG + Intergenic
924925526 1:248676545-248676567 CGCCAGCCTCGGCCTCCCGGAGG + Intergenic
1062794489 10:333506-333528 CGCCTGCCACGTCCACATGGTGG - Intronic
1066114298 10:32226098-32226120 CACCAGCCACGCCCACCCTGGGG + Intergenic
1068788347 10:61001436-61001458 CGCCAGCCTCGGCCGCCCGGCGG - Intronic
1069602697 10:69718107-69718129 GGCCTGCGGCGCCCACCCTCAGG - Intergenic
1070865220 10:79704509-79704531 CCCCAGCCTCGCCCACCCAGGGG - Intronic
1070879011 10:79842640-79842662 CCCCAGCCTCGCCCACCCAGGGG - Intronic
1071632118 10:87226730-87226752 CCCCAGCCTCGCCCACCCAGGGG - Intronic
1071645571 10:87358949-87358971 CCCCAGCCTCGCCCACCCAGGGG - Intronic
1073106008 10:101032333-101032355 TCCCGGCCGCGCCCACCCGGTGG - Exonic
1075207938 10:120462831-120462853 CGCCTGCTGCCTCCACCCTGCGG - Intronic
1076395911 10:130136962-130136984 AGCCTGCCGCTCCCTCCCGGCGG - Intronic
1076792304 10:132784105-132784127 GGCCCGCAGCGCCCAGCCGGGGG - Intergenic
1076792757 10:132785732-132785754 CGCCCGCCGCGCCCACGGGCCGG + Exonic
1077018562 11:407386-407408 CCCGTGCCCCGCCCACCCGGAGG - Intronic
1077364626 11:2156523-2156545 CCCCTGCCGGGCACTCCCGGGGG - Intronic
1077365423 11:2159589-2159611 TGCCTGCTGCCCCCACCCTGTGG - Intronic
1077460813 11:2708500-2708522 TGCCTGCCTGGCCCACCAGGGGG - Intronic
1077499317 11:2902097-2902119 CCCCTGCCCCGCCCACCAGCGGG - Intronic
1077771448 11:5223470-5223492 CGCCTGCCTCGGCCACCCAAAGG - Intergenic
1081906922 11:46676065-46676087 CACCTGCCAGGCCCACACGGAGG - Intergenic
1083572549 11:63768340-63768362 CGCGCTCCGCGCCCACCAGGTGG + Intronic
1083587931 11:63873889-63873911 CGCCTGCCTCGGCCTCCCGAGGG + Intronic
1083747771 11:64745007-64745029 CCCCTGCCGCGCCGCCCGGGAGG + Intronic
1083849214 11:65355394-65355416 CGCCTCCCACTCCCTCCCGGGGG + Intronic
1084310213 11:68312489-68312511 CACCGGCCGCGCCCTCCCGCGGG - Intergenic
1085483772 11:76844311-76844333 CTCCGGCCGCTCCCACCCTGTGG + Intergenic
1091715834 12:2775544-2775566 GGCCTGCCGCACCCACCAGCTGG + Intergenic
1096472420 12:51888052-51888074 CTCAGGCCCCGCCCACCCGGAGG + Exonic
1096622689 12:52874345-52874367 CGCCGGCCGCGCCCGCTCCGCGG + Intergenic
1104069774 12:125334375-125334397 CCCCTTCCTCGCCCACCAGGAGG - Intronic
1104904544 12:132206181-132206203 CGCCTGCCTTGCCCACCCCCTGG + Intronic
1107508562 13:41060195-41060217 TGCCTTCCGCGCCCTCCCGGGGG - Intronic
1110450677 13:75635770-75635792 CGGCGGCCGGGCCCTCCCGGCGG - Intronic
1112402467 13:99087669-99087691 CGCCTGGCGCGCCCTCTCCGCGG - Intergenic
1112570417 13:100588684-100588706 CGCCTGCTCCGCCCCCCAGGCGG - Intronic
1113707789 13:112445568-112445590 CGCCTGCCGCCCCCTCCATGGGG - Intergenic
1115120096 14:29927942-29927964 CGACTCCCGCGCCCGCCGGGTGG - Intronic
1115761628 14:36582456-36582478 CGCCTCCCACGCCCATCCGTAGG - Exonic
1124176092 15:27425358-27425380 CGCCTGCCTCGGCCTCCCAGTGG - Intronic
1129468702 15:75738481-75738503 TGCCTGCTGCGTCCACCCTGGGG - Intergenic
1131367566 15:91853429-91853451 CGCCTCCCGTGCCTCCCCGGGGG + Intergenic
1132275397 15:100559115-100559137 CGGCAGCTGCTCCCACCCGGGGG - Intergenic
1132903065 16:2268686-2268708 CGCCTGCCGCGCCCACCCGGTGG - Intergenic
1133271940 16:4614596-4614618 CGCCGTCCGCCCCCGCCCGGCGG + Intronic
1136188328 16:28601005-28601027 GCCCTGCCGCGCCCAACCGCGGG + Intergenic
1136190800 16:28613999-28614021 GCCCTGCCGCGCCCAACCGCGGG + Intronic
1136365205 16:29806459-29806481 GGCCTCCCGCCCCCACCCAGGGG + Intronic
1136553294 16:30993114-30993136 CGCCTGCCCCGCTCACCCTCCGG + Exonic
1136634133 16:31508405-31508427 CGCCTGCCACGTCCACCGTGCGG - Exonic
1137003997 16:35255618-35255640 CGCCCTCCGCTCCCACCCGCGGG + Intergenic
1137033139 16:35543716-35543738 CGCCCCCCGCGCCCACCCACGGG + Intergenic
1138180564 16:54937847-54937869 CGGCTGCAGCCCCCACCCGCAGG - Intergenic
1139549736 16:67666710-67666732 CGCCAGCCGCTGCCACCCGACGG + Exonic
1141682667 16:85553525-85553547 CGCCTGGCGCCCCCTCCCAGCGG - Intergenic
1142400517 16:89855962-89855984 AGCCTGCCAGGCCCACCCGGAGG - Intronic
1144500910 17:15786372-15786394 CGCCTGCTGCCCCGTCCCGGCGG + Intergenic
1144692902 17:17280698-17280720 CGCCTCCCGCCCGCTCCCGGCGG + Intronic
1145163072 17:20589034-20589056 CGCCTGCTGCCCCGTCCCGGCGG + Intergenic
1146403666 17:32519454-32519476 CGCCGCCAGAGCCCACCCGGCGG - Intronic
1148159166 17:45440329-45440351 CCCCTGCCCCGCCCAGGCGGGGG - Intronic
1148262236 17:46193547-46193569 CGCCCGCCGCGCCGCCCCCGCGG + Intronic
1148878561 17:50707686-50707708 CGCCTGCCCCGCCCCGCCCGGGG + Exonic
1150488915 17:65561350-65561372 CGCCCCCCGCGCCCACGCCGCGG + Intronic
1151978332 17:77494872-77494894 CCCCTGCCGGGCCCACCCTGCGG + Intronic
1152684500 17:81687421-81687443 CACCTGCCCTGCCCACCCAGTGG - Intronic
1152689727 17:81712486-81712508 CGCCTGCTGCACGCACCCGCTGG + Exonic
1154384042 18:13877486-13877508 CTCCAGCCGCTCCCACCCTGTGG + Intergenic
1160681075 19:411919-411941 CGCCTGCCTCGCACACATGGTGG - Intergenic
1160690863 19:460353-460375 CGGCGGCTGCCCCCACCCGGAGG - Intronic
1161173303 19:2824189-2824211 CTCCTGCCTCGCCCACTTGGAGG + Intronic
1161350095 19:3786446-3786468 CGCCTCCCGCGCGCCCCGGGCGG + Intronic
1161510018 19:4665067-4665089 CCCCTGCCCCGCCCTCCTGGTGG + Intronic
1162018977 19:7860194-7860216 CCCCTGCCTCGCCCACCATGTGG + Intronic
1163607103 19:18281494-18281516 CCCCCGCCGCGCCGGCCCGGGGG + Exonic
1164244738 19:23419543-23419565 GGCCAGCCGCCCCGACCCGGAGG + Intergenic
1164713471 19:30375421-30375443 CGCCTGCTGCTCCCACCACGCGG + Intronic
1165431368 19:35775411-35775433 CCGATGCCCCGCCCACCCGGAGG - Intronic
1166042793 19:40213598-40213620 TGCCTGCCGAGCCCTCCCCGGGG + Exonic
1168346801 19:55653868-55653890 CGTCTGCCGCGCCTGCGCGGCGG + Intergenic
926197965 2:10775092-10775114 CTCCTCCCGCCCCTACCCGGAGG + Intronic
927985779 2:27409488-27409510 CTCCTGCCGCGCGCACCCCCGGG - Exonic
934545088 2:95207689-95207711 AGCCTGGCGCCCCCACCCGGGGG - Exonic
938319897 2:130355824-130355846 CGGCTGCCGCGCCCACTGGTGGG - Intergenic
938876028 2:135531912-135531934 TGCCCACCGCCCCCACCCGGGGG + Intronic
943060478 2:183037902-183037924 CTCCTGCCGCCCCCACCCCACGG + Intronic
1169059635 20:2652389-2652411 CGCCTGCAGTGCCCGACCGGGGG + Exonic
1172539365 20:35699205-35699227 AGCCCGCGGCGCCCACTCGGGGG - Exonic
1175904305 20:62372091-62372113 CGGCTGCAGCGTCCACCCCGAGG + Intergenic
1177188112 21:17819671-17819693 CGCCTGCGGCCCCCGCCCCGGGG - Intergenic
1180105643 21:45616579-45616601 CGTCTGCCTCACCCACCCAGAGG + Intergenic
1180156386 21:45979416-45979438 CTCCCGCCGCACCCACCCCGCGG + Intergenic
1180612295 22:17105795-17105817 GGCCTGCCCTGCCCACCCTGAGG - Intronic
1181745423 22:24952606-24952628 CGCCGGCCGCGCCTGCGCGGAGG - Intergenic
1183477250 22:38042443-38042465 GGCCTGCCCCACCCACCTGGAGG + Intergenic
1183530993 22:38353312-38353334 CGCCCGCGGCGGCCACACGGGGG - Intronic
1183537677 22:38412812-38412834 TTCCTGCCGCGAGCACCCGGGGG - Intergenic
950417227 3:12875619-12875641 AGACTCCCTCGCCCACCCGGGGG + Intergenic
961698987 3:128726742-128726764 CCGCCGCCGTGCCCACCCGGCGG + Intronic
962263199 3:133927773-133927795 ACCCCGCCTCGCCCACCCGGCGG + Intergenic
968450685 4:674712-674734 CGCGGACCGCGCCCACCCGAGGG + Intronic
968663091 4:1806852-1806874 GGCATGCCGCGCCCTCCCAGAGG + Exonic
968701415 4:2059725-2059747 CACACGCCGCGCCCCCCCGGCGG - Exonic
969023399 4:4154075-4154097 CGCCTGCCTCGGCCTCCCAGAGG - Intergenic
969537126 4:7763294-7763316 CGCCTTGCACGCCCACCAGGAGG - Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
980056647 4:128084376-128084398 CGCCAGCCTCGGCCTCCCGGAGG - Intronic
982202954 4:152976294-152976316 GACCTGCCGCGCCCACTCCGAGG + Exonic
983649784 4:170026494-170026516 CGGCTGCCGCGAAAACCCGGCGG - Intronic
985533326 5:446611-446633 CGCCTGCCTCGGCCTCCCCGAGG - Intronic
989097932 5:37798032-37798054 CGCCTGCTGAGACCACCCGTTGG - Intergenic
992364958 5:76082292-76082314 GGCCTGGCGCACCCACCCCGCGG - Intergenic
1002364934 5:178702541-178702563 CGCCTGCCTCGCCCTCCCAAAGG + Intergenic
1003603684 6:7541529-7541551 CGCCTTCCCCGCCCCCCCGCGGG - Intergenic
1018013612 6:159693356-159693378 CGCCCGCCGCGCCCAACCCCGGG + Intronic
1019153467 6:170023875-170023897 CGTCTGGGGCGCACACCCGGGGG - Intergenic
1019407104 7:889553-889575 CGCCTGCCTCTCCCACCTAGTGG - Intronic
1019554185 7:1620381-1620403 CTCCTGCCTCGGCCTCCCGGTGG + Intergenic
1019593027 7:1845051-1845073 TGCCTCCCGCGCCCGCCAGGTGG - Intronic
1019731566 7:2632118-2632140 CGCAGGCCGCGCGCATCCGGAGG + Exonic
1019900119 7:4013882-4013904 AGCCTGCGGCCCCCACCCCGAGG - Intronic
1023842435 7:44104838-44104860 CGCCTCCCGAGCCCACCCCGCGG + Exonic
1023978170 7:45048518-45048540 CGCCTGCCTCGGCCTCCCAGAGG - Intronic
1024010173 7:45260191-45260213 CGTCTGCCGCCCCCTGCCGGCGG + Intergenic
1024621222 7:51159126-51159148 CCCCGGCCGCGCGCACCTGGCGG + Intronic
1029437290 7:100570360-100570382 CGCCTGCCGCCGCCACGCGCAGG - Intergenic
1029620068 7:101684829-101684851 CGCCAGCGGTGCCCACCCTGAGG + Intergenic
1034470560 7:151252176-151252198 CTCCTGCCGCGCCCCCCGAGCGG - Intronic
1034911567 7:155002669-155002691 GGCCTCCCGCGCCCACCCCGCGG + Intronic
1035168988 7:157007489-157007511 CCCCTGCCGCCCGCACCCTGAGG - Intronic
1035441512 7:158905383-158905405 CGCCTGCCTCGGCCTCCCAGAGG + Intronic
1035751849 8:2002062-2002084 CGCCGGCCGCGCCCACCTCTTGG + Exonic
1036398264 8:8386589-8386611 CGCCTGCCGCTCCCACCCGGCGG + Intergenic
1036950243 8:13133305-13133327 CGCCAGCCGGGCCCTCCCGCTGG + Intronic
1037336945 8:17801211-17801233 CGCCTGCGGCGGCTACCAGGCGG + Intergenic
1037787700 8:21912357-21912379 CGCCGGCCTCGGCCACCCGCAGG + Exonic
1038304040 8:26383292-26383314 CGCCTCCCGCGCCGCGCCGGTGG - Intronic
1039936570 8:42051584-42051606 CGCCGGCCGGGCCCGCCCTGGGG - Intronic
1040313814 8:46250460-46250482 GGCCTGCCATGCCCACCCTGTGG - Intergenic
1040807325 8:51408780-51408802 CTCCTGTCGCGCGCACTCGGTGG + Exonic
1046962349 8:120124881-120124903 CGGCTGCCGCGCGCACCTGGGGG + Intronic
1047291152 8:123531588-123531610 CCCCTTCCGAGCCCACCCTGTGG - Intronic
1049562412 8:143318332-143318354 CACCTGCCGCGGTCACCCAGGGG - Intronic
1049624852 8:143615345-143615367 CGCTTGCCGGGTCCACCCCGCGG + Intronic
1053239871 9:36487239-36487261 CGCCTCCGGCCCCCACCCGCGGG + Intronic
1053656426 9:40222183-40222205 CACCTGCCGCGCGGACCCTGGGG + Intergenic
1054368531 9:64368405-64368427 CACCTGCCGCGCGGACCCTGGGG + Intergenic
1054528191 9:66154102-66154124 CACCTGCCGCGCGGACCCTGGGG - Intergenic
1054676156 9:67858157-67858179 CACCTGCCGCGCGGACCCTGGGG + Intergenic
1056094925 9:83243081-83243103 CGGCTGCCGAGCCCACTGGGTGG + Intronic
1056991970 9:91421379-91421401 CCGCTGCGCCGCCCACCCGGAGG - Intronic
1060968553 9:127724914-127724936 GGCCTGCCCCGCCCACCGTGGGG - Intronic
1061930947 9:133832911-133832933 GGCCTGGGGCGCCCACCTGGAGG - Intronic
1062696095 9:137877341-137877363 CGCGAGCCGAGCGCACCCGGAGG + Intergenic
1189262587 X:39689044-39689066 GCCCTGCCGCGCCCTCCCCGCGG - Intergenic
1190354282 X:49589923-49589945 CGCCTGCCTCGCCCCCGCCGGGG - Intronic