ID: 1132904303

View in Genome Browser
Species Human (GRCh38)
Location 16:2274264-2274286
Sequence AGCACGCTGCCAGCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132904303_1132904307 -9 Left 1132904303 16:2274264-2274286 CCTGCTGGTGCTGGCAGCGTGCT No data
Right 1132904307 16:2274278-2274300 CAGCGTGCTACCGGGAAGGATGG No data
1132904303_1132904310 21 Left 1132904303 16:2274264-2274286 CCTGCTGGTGCTGGCAGCGTGCT No data
Right 1132904310 16:2274308-2274330 TGTGCGTGTCCTGTGTACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132904303 Original CRISPR AGCACGCTGCCAGCACCAGC AGG (reversed) Intergenic
No off target data available for this crispr