ID: 1132905897

View in Genome Browser
Species Human (GRCh38)
Location 16:2282765-2282787
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 4, 1: 2, 2: 3, 3: 28, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132905897_1132905911 24 Left 1132905897 16:2282765-2282787 CCCTGGGCACCACCTCTGCTCAG 0: 4
1: 2
2: 3
3: 28
4: 316
Right 1132905911 16:2282812-2282834 ACATCCCCTCCTCCGGGCACTGG 0: 4
1: 1
2: 0
3: 30
4: 168
1132905897_1132905906 17 Left 1132905897 16:2282765-2282787 CCCTGGGCACCACCTCTGCTCAG 0: 4
1: 2
2: 3
3: 28
4: 316
Right 1132905906 16:2282805-2282827 CAGCCCCACATCCCCTCCTCCGG 0: 5
1: 0
2: 10
3: 57
4: 455
1132905897_1132905907 18 Left 1132905897 16:2282765-2282787 CCCTGGGCACCACCTCTGCTCAG 0: 4
1: 2
2: 3
3: 28
4: 316
Right 1132905907 16:2282806-2282828 AGCCCCACATCCCCTCCTCCGGG 0: 5
1: 1
2: 5
3: 86
4: 518
1132905897_1132905912 25 Left 1132905897 16:2282765-2282787 CCCTGGGCACCACCTCTGCTCAG 0: 4
1: 2
2: 3
3: 28
4: 316
Right 1132905912 16:2282813-2282835 CATCCCCTCCTCCGGGCACTGGG 0: 4
1: 1
2: 0
3: 26
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132905897 Original CRISPR CTGAGCAGAGGTGGTGCCCA GGG (reversed) Intronic
900653247 1:3741720-3741742 CAGAGCACAGGTGGAGGCCATGG - Intergenic
900797831 1:4719993-4720015 CTGGGCAGAGGTGGGGCAGAGGG - Intronic
900809105 1:4787656-4787678 CTGGGCAGAGCCAGTGCCCAGGG - Exonic
901059530 1:6465680-6465702 CCGGGCAGAAGGGGTGCCCATGG + Intronic
901190775 1:7408562-7408584 CAGGGCAGAGGTGCTGCCCAGGG - Intronic
901420887 1:9150380-9150402 GGGAGCAGGGGAGGTGCCCAGGG + Intergenic
902092148 1:13912170-13912192 CTGGGTAAAGGGGGTGCCCAGGG - Intergenic
902372790 1:16016389-16016411 CTGAACAGGGGCGTTGCCCAGGG - Intronic
903130658 1:21277438-21277460 CTGTGCAGACGTGCTGGCCAGGG + Intronic
903269068 1:22176580-22176602 CTCAGCAGAGGGGGTGCTCAGGG + Intergenic
903359521 1:22768021-22768043 CTGAGCAGAGATGGCACCCTGGG + Intronic
904039690 1:27576696-27576718 CAGAGCAGAAGGGGTCCCCAGGG - Intronic
904058333 1:27686776-27686798 CAGAGCAGAGGCGGTGCCCACGG + Intergenic
904927081 1:34057715-34057737 GTGGGCAGAGCTGGAGCCCATGG - Intronic
904974523 1:34445595-34445617 CTCAGCAGAGTTGATGCCCCTGG - Intergenic
905226698 1:36483287-36483309 CTGTGAAGATGTGGTCCCCAAGG - Intergenic
905348993 1:37331558-37331580 CTGAGCAGAGGTAGGGGGCAGGG - Intergenic
906937815 1:50229685-50229707 CTGCTCAAAGGTGGTGACCACGG - Intergenic
908354708 1:63318497-63318519 AAGGGCAGAGGTGGTACCCAAGG - Intergenic
909358226 1:74732658-74732680 CTGGGCAGGGGTAGTGCCAACGG + Intronic
909779168 1:79521233-79521255 CTGAGCAGAGCTGGTCCTGAGGG + Intergenic
911299961 1:96159944-96159966 CTGAGCTATGGTGGAGCCCAAGG + Intergenic
912707204 1:111923750-111923772 CTCAGCAGAGGTGCAGCGCAGGG + Intronic
914379389 1:147102820-147102842 CTGAGCAGAAGTGGAACCCTGGG + Intergenic
915424554 1:155813747-155813769 CAGTGCTGAGGTAGTGCCCATGG - Exonic
916675540 1:167062013-167062035 CTGAGAAGATGAGGTGCCCCGGG - Intronic
916797540 1:168180603-168180625 TTGAGCAGAGGGAGTGACCAGGG + Intronic
917614916 1:176732949-176732971 CTGACAAGAGGTGGAGCTCAGGG - Intronic
917708673 1:177660718-177660740 CTTACCAGAGGAGTTGCCCAGGG + Intergenic
918459231 1:184758587-184758609 CTTATCAAAGGTGGAGCCCATGG + Intergenic
920009215 1:202855626-202855648 CTGTGGAGAAGTGGTGCCCAAGG - Intergenic
920092918 1:203466910-203466932 CTGTGCAGAGCTGTGGCCCAGGG + Intergenic
921012907 1:211160982-211161004 CTTAGCAGTGGTTGTGGCCAAGG + Intergenic
1063375123 10:5550147-5550169 CTGAGCACAGGTGGTTCAAATGG - Intergenic
1064029284 10:11873549-11873571 CTGAGCAGAGGTGATGAGCAAGG + Intergenic
1067130834 10:43564017-43564039 CTGAGAAGAGGTGGTGAACATGG - Intronic
1067208795 10:44241822-44241844 CTAAGCAGAGCTGGTACCCTAGG + Intergenic
1067328579 10:45293120-45293142 GTGAGCACAGTTGCTGCCCAAGG + Intergenic
1068461679 10:57337194-57337216 CAGAGCAGAGGTGGAGGCCCAGG + Intergenic
1069793888 10:71040349-71040371 CTGCCCAGAGGAGGTGCTCATGG + Intergenic
1069879463 10:71582797-71582819 CTGAGAAGTGGTGGAGACCAGGG + Intronic
1070587870 10:77780099-77780121 CTGAGCAGGGGGGGCTCCCAGGG + Intergenic
1070637823 10:78143296-78143318 CTGAGCAGAGGTGGAGAGCAGGG + Intergenic
1070778697 10:79125240-79125262 CTGAGCTGAGGTCAGGCCCATGG - Intronic
1071348958 10:84720259-84720281 ATGAGGACAGGTGGAGCCCAAGG - Intergenic
1075711992 10:124535872-124535894 CAGAGCAGAACTGGTGCTCAGGG - Intronic
1075735020 10:124659259-124659281 CTGAGCAGAGCTGCTCACCAAGG + Intronic
1076509247 10:131000375-131000397 CTGATCAGAGTTGATGGCCATGG - Intergenic
1077399560 11:2347248-2347270 CTGAGCAGGGATGGTGACCAGGG + Intergenic
1078363319 11:10687114-10687136 GGGAGGAGAGGGGGTGCCCATGG + Intronic
1082001932 11:47398024-47398046 CTGGGAAGAGGTGGTGGCCGTGG - Intergenic
1082773881 11:57230959-57230981 CTGGGCAGAGGAATTGCCCACGG - Intergenic
1083260008 11:61517814-61517836 CTGAGCAGAGGGGGGCACCAAGG + Intronic
1083746904 11:64741946-64741968 CTGGGCAGAGGGGCTGCGCATGG + Intronic
1083991105 11:66246279-66246301 CTGTGCAGAGCTGGGGGCCAGGG + Intergenic
1084321375 11:68375268-68375290 CTCAGCAGACTTGGGGCCCAGGG - Intronic
1085260155 11:75199992-75200014 CTGGGCTGAGGTGGTGGGCAGGG - Intronic
1086219273 11:84421752-84421774 CTGAGCAGAGCAGGTACACAAGG - Intronic
1087377797 11:97366465-97366487 CTGAACATAGGTGTTGGCCAGGG + Intergenic
1088008382 11:104969556-104969578 CTTAGCAGAGATGGTGCACTGGG - Intergenic
1088338450 11:108735481-108735503 ATGATCAGAGGTGGTCACCATGG + Intronic
1088737705 11:112741792-112741814 ATGAGCAGAGATGTGGCCCAAGG + Intergenic
1089589356 11:119530578-119530600 ATTAGCAGAGGTTCTGCCCAGGG - Intergenic
1090627107 11:128617179-128617201 CTGGGAAGAGGAGCTGCCCAGGG + Intergenic
1091672478 12:2462233-2462255 CTGAGCCGAGGTGGGGGCCAAGG - Intronic
1091786328 12:3245293-3245315 TTGGCCAGGGGTGGTGCCCAGGG + Intronic
1097415896 12:59316446-59316468 GTGAGCCGAGATCGTGCCCACGG - Intergenic
1098300391 12:69048149-69048171 GTGATCAGAGGTGGGGTCCAGGG + Intergenic
1102104975 12:110313613-110313635 CTTAGGAAAGGTGGTTCCCATGG - Intronic
1102998128 12:117365115-117365137 CAGTGCAGAGGTGGACCCCAGGG + Intronic
1103347342 12:120260017-120260039 CTGAGCAGAGGAGGTGGCAAGGG + Intronic
1103938483 12:124489144-124489166 CTGACCTGAGGTGGAGCCCAAGG + Intronic
1104014585 12:124953501-124953523 CTGAGCTGAGGTAGAGTCCAGGG + Intronic
1104049297 12:125185590-125185612 CGGAGCGGAGGTGTTGCGCAGGG - Intergenic
1104331922 12:127855031-127855053 CTGAGCAAATGTGTTTCCCAGGG + Intergenic
1104785180 12:131444362-131444384 CTGGGCCAAGGTGGAGCCCACGG + Intergenic
1104935884 12:132364216-132364238 ATGAGCAGAGATGGTGGCCTCGG - Intergenic
1106762505 13:32880899-32880921 CTGCCCAGAGCTGGTCCCCATGG - Intergenic
1107029155 13:35833236-35833258 ATGAGCAGGGATGGTGCCCCCGG - Intronic
1110573245 13:77028065-77028087 CTGAAAAGCAGTGGTGCCCAGGG + Intergenic
1112268002 13:97942999-97943021 TTGAGCAAAGGTGGTACCCCTGG + Intergenic
1113434707 13:110281911-110281933 CTGAGCAGGGAAGGTGGCCAGGG - Intronic
1113647749 13:112011100-112011122 CTGGGCAGAGGGGCTGTCCAAGG - Intergenic
1113837282 13:113336641-113336663 CAGTGCAGAGGTAGGGCCCAGGG - Intronic
1114190604 14:20437069-20437091 CTGTCCAGAGGTGGGGTCCAGGG + Intergenic
1116045616 14:39739773-39739795 CAGAGCTCAGCTGGTGCCCATGG + Intergenic
1118611881 14:67547668-67547690 CTAAGCAGAGATGGTCCCCCAGG - Intronic
1119494855 14:75069720-75069742 CTGAGCAGGAGCGGTGCCCGAGG + Exonic
1121016682 14:90553184-90553206 GTGAGCAGAGGTGCTGCACCTGG - Intronic
1121220047 14:92278188-92278210 CTGACCAGAGGAGGTGGTCAGGG + Intergenic
1122290540 14:100678313-100678335 CTGGGCAGGGGTGGGGGCCAGGG + Intergenic
1122356702 14:101126973-101126995 CTGAGCAGAGGTAGGGGCCCCGG - Intergenic
1122364123 14:101184090-101184112 GTGAAGAGAGGTGGGGCCCAGGG - Intergenic
1122607623 14:102957919-102957941 CTGAGGAGAGTTTGTGCCAAAGG + Intronic
1123941087 15:25216968-25216990 CTGAGCAGTGGAGGTGCTCTTGG + Intergenic
1124412651 15:29449326-29449348 TTGAGCTGAGGTGCTGGCCATGG + Intronic
1125831003 15:42717132-42717154 CTGGGCAGATGAGGAGCCCAAGG + Intronic
1126083143 15:44985224-44985246 GTGAGCAGAGATGGTGCCACTGG - Intergenic
1127719050 15:61681756-61681778 CTGAGTACAGGTGGTGAGCAAGG + Intergenic
1128559339 15:68654459-68654481 CTGGGCAGAGTTAGGGCCCATGG - Intronic
1128702164 15:69812773-69812795 CTGAGCAGGGGAGGTTACCATGG - Intergenic
1129171334 15:73809990-73810012 CTCAGCTGAGTTAGTGCCCAGGG - Intergenic
1129188911 15:73926570-73926592 CAGGGCAGGGGCGGTGCCCAGGG - Exonic
1129597335 15:76975101-76975123 CTGAGCAGAGGTGTGGCAGAGGG - Intergenic
1129739089 15:77981345-77981367 TTGTGCATAGGTTGTGCCCAGGG - Intergenic
1129846869 15:78771844-78771866 TTGTGCATAGGTTGTGCCCAGGG + Intronic
1129851966 15:78798615-78798637 CCGAGCGGAGGAGATGCCCACGG + Intronic
1131173157 15:90192393-90192415 CTGGGCAGAGGCTGTACCCATGG + Intronic
1131303599 15:91221633-91221655 CTGGACAAAGGTGGTGGCCATGG - Intronic
1132051251 15:98609558-98609580 CAGAGCAGAGGTGCTCCCCTTGG + Intergenic
1132303124 15:100788660-100788682 CTGGGGGGAGGTGATGCCCATGG + Intergenic
1132785117 16:1652603-1652625 GGGACCAGAGGCGGTGCCCATGG + Intronic
1132870447 16:2113398-2113420 CAGAGGAGAGGAGGTGCCCGGGG + Intronic
1132905849 16:2282617-2282639 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905873 16:2282691-2282713 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905897 16:2282765-2282787 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905920 16:2282839-2282861 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905943 16:2282913-2282935 CTGAGGAGAGGTGGTGCCCAGGG - Intronic
1133854115 16:9533718-9533740 GAGAGCAGAGTGGGTGCCCATGG + Intergenic
1134522093 16:14923527-14923549 CAGAGGAGAGGAGGTGCCCGGGG - Intronic
1134709762 16:16322178-16322200 CAGAGGAGAGGAGGTGCCCGGGG - Intergenic
1134949841 16:18346467-18346489 CAGAGGAGAGGAGGTGCCCGGGG + Intergenic
1137254008 16:46760385-46760407 CTGAGCACAGGGCCTGCCCACGG - Intronic
1137583613 16:49650556-49650578 CTGTGCAGTGGTGGTGGTCATGG + Intronic
1137661040 16:50206636-50206658 CTGAGCAGAGGGGCTGGCCGTGG + Intronic
1139362050 16:66406141-66406163 CCAAGCAGAGGAGGTGACCAGGG - Intergenic
1139395521 16:66635616-66635638 CTCAGCAGCTGAGGTGCCCACGG + Intronic
1139891045 16:70253486-70253508 CAGAGCAGGGGCTGTGCCCAGGG + Intronic
1142140039 16:88468766-88468788 ATGAGCAGGGGTGAGGCCCAGGG + Intronic
1142141295 16:88473891-88473913 AAGAGCCGAGGGGGTGCCCAGGG - Intronic
1142193924 16:88730782-88730804 CTCAGCAGAGGGGAGGCCCAGGG + Intronic
1143388835 17:6548217-6548239 CTGAGCAAAGATGGGACCCAAGG + Intronic
1143610041 17:8012891-8012913 TTCAGAAAAGGTGGTGCCCAGGG - Intronic
1144644522 17:16963085-16963107 AAGAGCAGAAGTCGTGCCCAAGG - Intronic
1146125177 17:30225708-30225730 CACAGCAGAGGTGGGGTCCACGG - Intronic
1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG + Intronic
1147532008 17:41288128-41288150 ATCAGCAGAGGTGGTGGACAGGG - Intergenic
1147618672 17:41847050-41847072 GTGAGCAGAGATGGTGCAAATGG + Intronic
1148681425 17:49476142-49476164 GTGGGCAGGGGTGGTGCCTATGG - Intronic
1151034960 17:70788123-70788145 CTGAGCTGGGATGGTGCCCATGG - Intergenic
1151215656 17:72574981-72575003 CTGCACAGAGGTGGGACCCAGGG + Intergenic
1151902668 17:77027198-77027220 ATGTGCAGAGGTGATGACCATGG - Intergenic
1151953052 17:77365806-77365828 CTGAGGCGACGTGGTCCCCAGGG - Intronic
1152471970 17:80494550-80494572 CTGCTCAGAGCTGGTGCCCAAGG - Intergenic
1152537857 17:80960814-80960836 CTCAGCAGAGGCAGTGCCCGGGG - Intronic
1153677118 18:7465662-7465684 CTGACAGGAGGTGGAGCCCAGGG + Intergenic
1154262854 18:12852957-12852979 CTGAGAAGAGGCTCTGCCCAAGG - Intronic
1155161415 18:23198783-23198805 GTTAGCAGAGCTGGTTCCCATGG - Intronic
1157683507 18:49625226-49625248 CTGCGCAGCTGTTGTGCCCAGGG + Intergenic
1157779099 18:50421290-50421312 CTGAGCAGGGGAGGTTCCCCCGG + Intergenic
1160392846 18:78548039-78548061 CTGGGCAGAGCTGGGGCCCCCGG - Intergenic
1160702294 19:513481-513503 CTGAGCAGCAGTGATGACCAGGG + Intronic
1162477333 19:10908373-10908395 CTGAGCACAGGTGGAGCTCAGGG + Intronic
1163105875 19:15122849-15122871 CTGAGCAGTGCTGGGGCCGAGGG - Intronic
1163159047 19:15454039-15454061 GTGAGCAGAGGTCAAGCCCAGGG - Intronic
1163608185 19:18287216-18287238 CTGAGCAGAGGTGGAGGCTTCGG - Intergenic
1163713119 19:18858682-18858704 CTGAGCAGAGGTGGACCCCAGGG + Intronic
1164656103 19:29923214-29923236 CTGAACAGGGGTGGGGGCCAGGG - Intergenic
1164979628 19:32604065-32604087 CTGGTCAGAGGTGGTGCTCTGGG - Intronic
1165138181 19:33684002-33684024 CTGGGCAGAGATAGTGTCCAGGG + Intronic
1165310406 19:35026268-35026290 CTGTGCAGACGTGGGGACCACGG + Exonic
1166833314 19:45651389-45651411 CTGAGCCAAGATGGTGCCCCTGG + Intergenic
1167160724 19:47765764-47765786 CTGAGCAGAGGTGGCGGGGAGGG + Intergenic
1167558906 19:50213495-50213517 CTGAGCTAAGGTGGTGGCCAGGG + Intronic
1167745964 19:51352043-51352065 CTGAGCAGAGGTGGTGCCCGAGG + Intronic
925073032 2:986240-986262 CTGAGCAGAGTTGTGGCCCCTGG + Intronic
925073145 2:987302-987324 GTGGGCAGAGATGGTCCCCATGG + Intronic
925934692 2:8744593-8744615 CTGAGCAGAGATGGGACCAATGG + Intronic
926151982 2:10430316-10430338 CTGAGCAGAGGTGGTTATAATGG - Intergenic
926276385 2:11406259-11406281 CTCAGCAGAGGTGGAGCTCCGGG - Intergenic
926854884 2:17244574-17244596 CTGAGAACATGTGGTCCCCAAGG + Intergenic
927139950 2:20123073-20123095 CAGAGCAGAGGTGATGTGCATGG - Intergenic
927188524 2:20499874-20499896 CTGAACAGAGGTGGGCCCCAGGG - Intergenic
928120586 2:28581044-28581066 ATGAGCAGGGGAGGGGCCCAGGG - Intronic
928176364 2:29036879-29036901 TAGGGCAGAGGTGGAGCCCAGGG + Intronic
930274525 2:49296077-49296099 CTGTGCAGCGGAGGAGCCCAAGG + Intergenic
931779119 2:65564612-65564634 CTGAGCAGAGGCTGTACCCTGGG - Intergenic
932348110 2:71008810-71008832 CTGGGCTGAGTTGTTGCCCACGG + Intergenic
932667369 2:73708282-73708304 CTGGGCAGACGGGGTGGCCAGGG - Intergenic
932780677 2:74556621-74556643 CTGAGCAGACGTGCTGTCCAAGG - Exonic
933979424 2:87538341-87538363 TCGTGCAGAGCTGGTGCCCAGGG + Intergenic
934761732 2:96860471-96860493 CTGAGCAGAGCAGGTCCTCATGG + Exonic
936084323 2:109456158-109456180 CAGGGCAGAGGTGGTTTCCATGG - Intronic
936314399 2:111412450-111412472 TCGTGCAGAGCTGGTGCCCAGGG - Intergenic
936351644 2:111717137-111717159 CTGGGAAGAGGTTCTGCCCAGGG + Intergenic
937686861 2:124707255-124707277 CTGCTCAGAGGTAATGCCCAGGG + Intronic
937916825 2:127103441-127103463 CTGGGCAGAGGGAGGGCCCAGGG - Intronic
938064401 2:128273260-128273282 CTGAGCAGAGAAGGTGCACAGGG - Intronic
938105611 2:128527947-128527969 CTGAGCACATGGGGTGGCCAAGG - Intergenic
939547462 2:143571001-143571023 CTGACAAGAGGTGGAGCTCAGGG - Intronic
939958362 2:148545524-148545546 CTGAGCAGAGGTGGCTCCTGGGG - Intergenic
946190215 2:218003884-218003906 CTGGGCAGAGGTGGGGGCGAGGG - Intergenic
946366218 2:219250720-219250742 CCGTGGAGATGTGGTGCCCAAGG - Exonic
946399173 2:219459839-219459861 CCGGGCAGAGGAGGGGCCCACGG - Intronic
946984803 2:225258899-225258921 GTGAACATAGGTGGTGGCCAGGG + Intergenic
947740049 2:232480853-232480875 CAGAGAAGAAGCGGTGCCCAGGG - Intronic
947960371 2:234231479-234231501 CTGTGCAGAGGTGGTGTGCTGGG - Intergenic
948869652 2:240791717-240791739 CAGGGCACAGATGGTGCCCAAGG + Intronic
1168734297 20:116565-116587 CTGAGAAGAGCTGGTGCCCCTGG - Intergenic
1170775746 20:19373317-19373339 CTTTGCAGAGGAGGTGACCATGG - Intronic
1171155199 20:22865585-22865607 CTGAGCTGACTTGGTGCCCACGG + Intergenic
1172196812 20:33097560-33097582 CTTAGCATAGGAGGTACCCAGGG - Intronic
1172696318 20:36825599-36825621 CTGAGCTGATGTGGTTGCCATGG - Intronic
1173395242 20:42673097-42673119 GTGGGCAGAGGAGGTCCCCAGGG + Intronic
1173466396 20:43285403-43285425 ATGAGCAACGGTGGTGGCCAGGG + Intergenic
1175434097 20:58930338-58930360 CTCAGCACAGGTGGGGCCCTGGG + Intergenic
1175505814 20:59483469-59483491 CTGAGGAGAGCTGGTGGCCGTGG + Intergenic
1175761008 20:61562174-61562196 CTGTGGAGAGGTGGACCCCAGGG + Intronic
1175822586 20:61918371-61918393 CTGGGCAGTGGTGGTGAACAAGG + Intronic
1176202138 20:63865858-63865880 CCGAGCAGAGTTGCTGCCCAAGG - Intronic
1176262245 20:64188002-64188024 CTGAGCAGATGTGGGGCCTCAGG + Intronic
1178719426 21:34995143-34995165 CTGAGCATGGCTGGTGGCCACGG + Intronic
1178909118 21:36660029-36660051 CTGGGCTGAGCTGGAGCCCAGGG - Intergenic
1179658448 21:42860038-42860060 CTGAGCAGAGCTGCTGCAGAGGG - Intronic
1180215136 21:46318750-46318772 AGGACCAGAGGGGGTGCCCAGGG + Intronic
1180228735 21:46413666-46413688 CTGAGCTGAGGTGAGGCCCACGG - Intronic
1180260386 21:46664521-46664543 CTGGGCAGCGGGGGTGGCCACGG - Exonic
1180564136 22:16648951-16648973 CTGGTGAGAGGTGGTGGCCAGGG + Intergenic
1181526487 22:23492188-23492210 CTTAGCAGAGGGGCTGTCCACGG + Intergenic
1183581340 22:38728336-38728358 CTGGGCAGTGGTGGTGACCATGG + Intronic
1183854516 22:40621637-40621659 CTGAGTAGAGTTTTTGCCCACGG - Intronic
1184455414 22:44607232-44607254 CTGAGCAGGGGTGGAGCAGAGGG + Intergenic
1184806105 22:46795963-46795985 CTGAGCAGAGGGGAGGACCATGG - Intronic
1184842262 22:47058895-47058917 TTGAGCAGTGGTGGGGCCCTGGG + Intronic
1184914350 22:47558982-47559004 CCTTGCAGAGGTGGTGGCCATGG + Intergenic
949479639 3:4481379-4481401 GTGAGCCGAGGTTGTGCCCCTGG - Intergenic
950121682 3:10485927-10485949 CTGAGCGGATGTGGGGGCCAGGG + Intronic
951024613 3:17816251-17816273 CAGTGCAGAGGTGGTTCCCCAGG - Intronic
952502704 3:33978790-33978812 CTGAGCAGAGGTGCTGGGAAAGG + Intergenic
954400442 3:50316900-50316922 GGGAGCAGGGGTGGTGCCCTTGG - Intergenic
955204568 3:56884163-56884185 GTGAGCAGAGGTGGTGATGATGG + Intronic
956921072 3:73930108-73930130 CTCAGCAGAGATGGTTCACAAGG - Intergenic
961357116 3:126346215-126346237 CTGAGCAGAGGAGCTGGCCCAGG + Intronic
961386285 3:126524995-126525017 CTCAGCACCGGTGGAGCCCAGGG - Intronic
961445288 3:126977764-126977786 CTGAAAAGAGGTGATGCCTATGG - Intergenic
961539175 3:127588996-127589018 GTGAGAAGGGGTGGAGCCCAGGG + Intronic
961539277 3:127589421-127589443 GTGAGAAGGGGTGGAGCCCAGGG + Intronic
961751200 3:129095828-129095850 CTGTGGAGAAGAGGTGCCCATGG + Intronic
963471144 3:145743527-145743549 TTGTGCAGAGGTTTTGCCCAGGG - Intergenic
965728114 3:171741603-171741625 CCAAGAAGAGATGGTGCCCATGG + Intronic
968123615 3:196143063-196143085 CTGAGCCGAGGGAGAGCCCATGG + Intergenic
968487005 4:867645-867667 CTGGGCCGAGGAGGTGCCGAGGG - Intronic
968574858 4:1360926-1360948 CTGAGCAGAGGTTGTGGGCCTGG - Intronic
968652474 4:1765735-1765757 CAGGGCTGAGGTGGAGCCCAGGG - Intergenic
968974007 4:3811706-3811728 CTGACCAGGGCTGGTGTCCAGGG - Intergenic
969437977 4:7199524-7199546 CTGAGCAGGGCTCCTGCCCATGG + Intronic
969537591 4:7766274-7766296 GTAAGCAGAGAAGGTGCCCAGGG + Intronic
969676734 4:8618550-8618572 CTTGGCAGACGTGGTCCCCAGGG - Intronic
969682781 4:8652451-8652473 CTGTGCAAAGCTGGTGCCCCAGG - Intergenic
970100769 4:12519168-12519190 CTGTTCAGAGGCTGTGCCCATGG + Intergenic
970362218 4:15321455-15321477 CTGAGCATTGCTGGTACCCATGG - Intergenic
970555343 4:17225891-17225913 CTGAGCAGGGGAGGTTCCCCTGG + Intergenic
972762133 4:42117181-42117203 CTGGGCAGAGATAGTCCCCAAGG - Exonic
978585428 4:110271441-110271463 CTGAGAGGAGGTGGAGCTCAGGG - Intergenic
981097111 4:140793192-140793214 CTGTGCAGAGGAGGCCCCCATGG + Intergenic
981770981 4:148307983-148308005 CTGAGCAGAGATGGTGGAGAAGG + Intronic
982719643 4:158847019-158847041 CAGAGCTCAGCTGGTGCCCACGG + Intronic
984252600 4:177352332-177352354 TTCAGCAGAGGCGGAGCCCATGG + Intronic
985938100 5:3112002-3112024 CAGAGCAGAGGTGGGACTCAGGG - Intergenic
986333410 5:6734747-6734769 CCTAGCAGAAGTGGTGCTCAGGG - Intronic
987644374 5:20649206-20649228 CTTAGCAGTGGTTGTGGCCAAGG - Intergenic
988128537 5:27073944-27073966 CTCAGCAGTGGTTGTGGCCAAGG - Intronic
989606053 5:43245669-43245691 CTGAGGACAGCAGGTGCCCAGGG - Exonic
993044224 5:82849046-82849068 TTGAGCGGAGGGGGTGCTCAGGG + Intergenic
993783339 5:92097480-92097502 CTGAGCATAGGCGGTAGCCAAGG - Intergenic
993913775 5:93716019-93716041 CTCAGCAGAGAGGGTTCCCATGG - Intronic
994320327 5:98387241-98387263 CAGAACACAGCTGGTGCCCATGG - Intergenic
999766509 5:154744980-154745002 GTGAGCAGAGATGGTGCCACTGG - Intronic
1001999864 5:176191618-176191640 CTGAGCAGAGGTGGGGCTCTGGG - Intergenic
1003163323 6:3654668-3654690 CTGTGCAGTGGTGGCACCCAGGG - Intergenic
1003566438 6:7226717-7226739 CTGAGGAGAGGAAGTTCCCATGG - Intronic
1005128857 6:22479894-22479916 CACAGCAGTGGTGGTGACCATGG - Intergenic
1005825407 6:29628838-29628860 CTGGGAGGAGGTGGAGCCCAGGG + Intronic
1006067533 6:31472833-31472855 CTGGGCAGAGGTGGTTCAGAAGG - Intergenic
1006079300 6:31556108-31556130 CTGAGCTCAGGTGGTGAGCATGG - Intronic
1006362213 6:33593011-33593033 CTGAGCAGAGGTGCTGGCCAAGG - Intergenic
1006652542 6:35563502-35563524 CTTAGCACAGGTGCTGCCCCTGG - Intergenic
1007250647 6:40492692-40492714 CCCAGCAGAGGAGGTGCCCCTGG - Intronic
1007308201 6:40923555-40923577 CTCAGCAGCTGTGGTTCCCAGGG - Intergenic
1007593245 6:43036074-43036096 TTCAGCAGGGGTGGTGCCAATGG + Intergenic
1007721688 6:43888923-43888945 CTCAGCAGAGATGGAGCCCCTGG - Intergenic
1008591157 6:52995058-52995080 CTGGGCAGAGGTGGGCCCCTTGG - Intronic
1016188405 6:141227374-141227396 ATGAGTAGAAGTGGTGACCATGG - Intergenic
1018338837 6:162827780-162827802 CTGAGCAGAGGAGGTGGATATGG - Intronic
1018346211 6:162901633-162901655 CTGAGCAAAGGCGGTGCCACAGG - Intronic
1018472859 6:164112050-164112072 CTGACCAGAGGTGTTGCCACGGG - Intergenic
1018838331 6:167501516-167501538 CTAAGCACTGGTGGTGCCCAAGG - Intergenic
1018910872 6:168100410-168100432 CTGAGCAGGGGTGGTGGGGAAGG - Intergenic
1019415196 7:923860-923882 CCCAGCAGCGCTGGTGCCCACGG - Intronic
1020119653 7:5495875-5495897 CAGAGCAGACGTGGTTCTCAGGG + Intronic
1021877797 7:25064656-25064678 CTGAGCAGAGGGAGTGGCTAGGG + Intergenic
1023202742 7:37716515-37716537 ATGAGGAGAGGTAATGCCCAGGG + Intronic
1023870621 7:44261320-44261342 CAGAGCAGAGGTGGTCCCAGGGG + Intronic
1023939607 7:44761256-44761278 CTCAGGAGAGATGCTGCCCATGG + Intronic
1023986430 7:45099847-45099869 CAGAGCAGAGGAGCTTCCCAGGG - Intergenic
1024630260 7:51241427-51241449 CTGGGCAGAGCTGGTCCCCTCGG + Intronic
1024655549 7:51448560-51448582 CTGATTAGAGGTGGTGGCGAGGG - Intergenic
1025144826 7:56493904-56493926 CTGTGCAGAGCTGGACCCCAGGG - Intergenic
1025260413 7:57414359-57414381 CTGTGCAGAGCTGGACCCCAGGG - Intergenic
1027267595 7:76502850-76502872 CAGAGCAGGGGCTGTGCCCAGGG + Intronic
1027545608 7:79524196-79524218 CAGGGCTGAGGTGGTACCCAGGG + Intergenic
1029364581 7:100108441-100108463 GGGAGCAGAGGAGGGGCCCAAGG + Exonic
1031020851 7:116626016-116626038 AAGAGCAGAGGAGGTTCCCAAGG - Intergenic
1031991800 7:128203369-128203391 TTGAACAGAGGTGATGGCCAAGG + Intergenic
1031995890 7:128230680-128230702 TTGAGGCGTGGTGGTGCCCAGGG + Intergenic
1033125220 7:138701399-138701421 CTGAGAAGAGGGTGTGCCCTAGG - Intergenic
1035033800 7:155882215-155882237 CGGGGCAGAGGCGGAGCCCACGG + Intergenic
1035044372 7:155954079-155954101 CTGAGCCTAGGTGGGGCCAAGGG + Intergenic
1035551767 8:533438-533460 CTGATCAGAGTTGGTGCCTTTGG - Intronic
1036449228 8:8850987-8851009 CAGAGCAGGTGTAGTGCCCAGGG - Intronic
1037826682 8:22164406-22164428 GTGGGCAGAGGTGGCGCCCAGGG + Exonic
1037907900 8:22726235-22726257 CTGAGCACAGGTGGGTGCCAGGG + Intronic
1039795448 8:40908999-40909021 GTGAGCAGAGATTGTGCCCTTGG + Intergenic
1042456264 8:69007601-69007623 CTGAGTAGAGGAGGTGAACAGGG + Intergenic
1043079983 8:75754896-75754918 CAGAACTCAGGTGGTGCCCATGG + Intergenic
1043200234 8:77360189-77360211 GTGAGCAGAGGTCGTGCCATTGG + Intergenic
1044315963 8:90750620-90750642 CTGGGCAGAGCTGGTGCCCCTGG + Intronic
1045054330 8:98356307-98356329 TTGGACAGGGGTGGTGCCCAGGG + Intergenic
1049148509 8:141019535-141019557 CTGGGCAGAGATGTGGCCCAAGG - Intergenic
1049196196 8:141316958-141316980 CTGAGCAGAGGAGGGACTCAGGG + Intergenic
1049345086 8:142134432-142134454 GTGAGCAGAGGGGGCACCCAGGG - Intergenic
1049545249 8:143227795-143227817 CAGGGCAGGGGTGGGGCCCAGGG - Intergenic
1049710793 8:144062470-144062492 CTGACCAGAGCTGCTTCCCACGG - Intronic
1049777300 8:144412697-144412719 CTGAGCAGAGGAGCTGAGCAGGG - Intronic
1050986578 9:12091074-12091096 CTGGGCAGAGCTGGAGCCCCTGG + Intergenic
1051677254 9:19570973-19570995 CTGAGCAGAGCTGTGGCCCTAGG - Intronic
1053420492 9:37974544-37974566 CTGAGCGCAGGTGGGGACCAAGG + Intronic
1058704791 9:107629307-107629329 CTGGGCTGAGGTGTTTCCCAGGG - Intergenic
1058834853 9:108851978-108852000 CTGAGGAGGGGTGGTGCCCGTGG - Intergenic
1060507244 9:124207390-124207412 GTGAGAAGAGGTGGGGCCAATGG - Intergenic
1060517470 9:124275019-124275041 CTAAGCAGAGCTCGTGCCCCTGG - Intronic
1060629871 9:125146096-125146118 CTGAGCATAGTGGGTGCCTAGGG + Intergenic
1061516772 9:131094707-131094729 CTGAGCTGAGCTGGATCCCACGG - Intergenic
1062337598 9:136079235-136079257 CTGAGCTGAGGGGGAGACCAGGG + Intronic
1062357537 9:136171915-136171937 CAGGGCAGGGGTGGGGCCCATGG - Intergenic
1062357925 9:136173802-136173824 CTGAGCAGAGCTGCTGCAGATGG - Intergenic
1062519601 9:136952165-136952187 GGCAGGAGAGGTGGTGCCCAGGG - Intronic
1062568653 9:137174455-137174477 CTGAGCAGAGGGTGACCCCAGGG + Intergenic
1187270636 X:17776477-17776499 CTGAGAACAGGCGGCGCCCATGG - Intergenic
1187319871 X:18229248-18229270 CTGAGAACAGGCGGCGCCCATGG + Intergenic
1189047747 X:37611336-37611358 CGGAGCAGAGGAGATGGCCAAGG - Intronic
1189216725 X:39331545-39331567 CTGAGAAGATGTGGTTCCCCTGG - Intergenic
1192135105 X:68589541-68589563 TGGAGCAGTGGTGGTGGCCATGG + Intergenic
1192836219 X:74802206-74802228 CTGAACATAGGTGGTATCCAGGG + Intronic
1193075997 X:77356287-77356309 CTGAGGAGATCTGGTGCCCGAGG + Intergenic
1194113798 X:89871987-89872009 CTGAGCAGAGCTGGATCCCCTGG + Intergenic
1195768361 X:108320506-108320528 CTGAGCACAGGCGGTGGGCAAGG + Intronic
1198599872 X:138270898-138270920 CTGAGCAGAATTGGTGTGCAAGG + Intergenic
1199118046 X:144015786-144015808 CTGACTAGAAGTGGAGCCCATGG - Intergenic
1200372242 X:155739430-155739452 CTGAGCAGATGTGCTGCACTAGG - Intergenic
1200466534 Y:3527342-3527364 CTGAGCAGAGCTGGATCCCCTGG + Intergenic
1201624454 Y:15998803-15998825 CTGGGGAGAGGTGATCCCCAAGG - Intergenic
1202600586 Y:26589918-26589940 CTGGTGAGAGGTGGTGGCCAGGG + Intergenic