ID: 1132906494

View in Genome Browser
Species Human (GRCh38)
Location 16:2285255-2285277
Sequence GGGTAAAGGCTGAGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132906479_1132906494 26 Left 1132906479 16:2285206-2285228 CCCGGAGCTGTAACCAGGATGGC 0: 1
1: 0
2: 2
3: 16
4: 144
Right 1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG 0: 1
1: 0
2: 0
3: 39
4: 313
1132906485_1132906494 -1 Left 1132906485 16:2285233-2285255 CCGGGTGCTGCCCATGCATGGAG 0: 1
1: 0
2: 2
3: 19
4: 200
Right 1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG 0: 1
1: 0
2: 0
3: 39
4: 313
1132906480_1132906494 25 Left 1132906480 16:2285207-2285229 CCGGAGCTGTAACCAGGATGGCT 0: 1
1: 0
2: 0
3: 15
4: 122
Right 1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG 0: 1
1: 0
2: 0
3: 39
4: 313
1132906483_1132906494 13 Left 1132906483 16:2285219-2285241 CCAGGATGGCTGCTCCGGGTGCT 0: 1
1: 0
2: 2
3: 20
4: 141
Right 1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG 0: 1
1: 0
2: 0
3: 39
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132906494 Original CRISPR GGGTAAAGGCTGAGGGTGCA GGG Intronic
900646945 1:3713316-3713338 GGGTGAAGGCAGAGGGGGCAGGG - Intronic
900803052 1:4749338-4749360 ATGTAAAGGCTGAGGTTCCAGGG - Intronic
901624197 1:10614408-10614430 GGGTGAAGGGTGAGGCTGCAGGG + Intronic
901638222 1:10680160-10680182 GGGCAAAGGCTGAGTAAGCAGGG + Intronic
901754582 1:11433872-11433894 AGGTAAGTTCTGAGGGTGCAGGG - Intergenic
901765501 1:11497346-11497368 GGGGGAAGGGTGAGGGGGCAAGG - Intronic
902533801 1:17107349-17107371 TGGCAGAGGCTGAGGGTGCTGGG + Intronic
904518599 1:31076544-31076566 TTGTAAAGGCAGGGGGTGCATGG + Intergenic
904617524 1:31757973-31757995 GGGTAAGGGCTGAGGATGGGGGG + Intronic
904750114 1:32736739-32736761 GGGAAAGAGGTGAGGGTGCAGGG - Intergenic
905270300 1:36783222-36783244 GGGCAAAAGCTGAGTGAGCAAGG + Intergenic
905830159 1:41059308-41059330 GGGTACAGGATAAGGGGGCATGG - Intronic
906205778 1:43985627-43985649 GAGTAAGGGGTGAGGGTGCTGGG - Intronic
908784337 1:67720234-67720256 GGGCACAGGATGAGTGTGCATGG - Intronic
909206921 1:72770168-72770190 GGGAAAAGGCTCATGGTGCAAGG - Intergenic
910557026 1:88545452-88545474 GGGTAAAGGCTGAGAGTGAGGGG + Intergenic
910626553 1:89313775-89313797 GGGTACAGGCTGAAGATGAATGG + Intergenic
910663940 1:89704203-89704225 GGTTAAAGGCTGAGGTTGGCGGG - Intronic
910909564 1:92218741-92218763 AGGTGAACGCTGAGCGTGCAGGG - Intronic
912383093 1:109258039-109258061 GTGTAGAGGCTGAGGGGGCAGGG + Intronic
914901115 1:151711629-151711651 GGGCAGATGCTCAGGGTGCATGG + Intronic
915106390 1:153537264-153537286 GGGTGGAGGGTGAGGGTGGAGGG + Exonic
917392358 1:174552314-174552336 GGGTGGAGGCGGAGGGTGGAAGG - Intronic
918472215 1:184885997-184886019 GGGTACAGACTGAGAGTGGAGGG - Intronic
919849299 1:201661762-201661784 GGCTACAGGCTGAGGGTGAGCGG - Intronic
920508135 1:206531478-206531500 GGCTGCAGGGTGAGGGTGCAGGG + Intronic
921363504 1:214352393-214352415 GGATAAAGGCTGAGTGTTGATGG + Exonic
922432765 1:225571863-225571885 GGGTAAGGTGTGAGGGTGCGGGG - Intronic
922911781 1:229224557-229224579 GGGGAAAGGGTTAGGATGCATGG + Intergenic
1064334353 10:14425315-14425337 GGGCAAAAGCTGGGGGTGGAGGG - Intronic
1065149420 10:22806803-22806825 AAGGAAAGGCTGAGGGCGCATGG - Intergenic
1065932866 10:30494801-30494823 GGCTAAAGGCCCAGGCTGCAGGG + Intergenic
1067570776 10:47369369-47369391 GAGCAGGGGCTGAGGGTGCATGG - Intronic
1072395119 10:95031609-95031631 GGGTAAATGCTGCAGCTGCAAGG - Intergenic
1072472956 10:95731419-95731441 TGGTGAGGGCTGAGGGTACATGG - Intronic
1072784554 10:98270795-98270817 GGGTACTGGCTGAGGGATCAGGG - Intergenic
1074115904 10:110457444-110457466 GAGGAGAGGCTGAGGGGGCACGG + Intergenic
1074585193 10:114761660-114761682 GGGGAAAGGCTGAGGATGTAGGG - Intergenic
1075426888 10:122348967-122348989 GGGTCACGGCTGAGGGTCCCTGG + Intergenic
1075976820 10:126703262-126703284 GGGTAAAGGGTGGGGAAGCATGG + Intergenic
1076048389 10:127313049-127313071 GGGCAATGGCTGAGGGTCAAGGG - Intronic
1076735673 10:132457894-132457916 AGGTAAAGGCTGAGGTTGGCTGG - Intergenic
1077170002 11:1161837-1161859 GGGCAGAGGCAGGGGGTGCAGGG + Intronic
1077264223 11:1641152-1641174 AGGTGAAGGCTGAGGGTGCTCGG - Intergenic
1077477269 11:2796445-2796467 GTATAAAGGCTGAAGGTGGAAGG - Intronic
1077799601 11:5524865-5524887 GGGTACAGGCAGAGGTTGGAGGG - Intronic
1081402739 11:42661775-42661797 GGGTTAAAGCTGAGTCTGCAGGG + Intergenic
1082808055 11:57462357-57462379 GGGCAGATGCTGAGGGGGCAGGG - Intronic
1083146371 11:60762736-60762758 GGGGAGATGTTGAGGGTGCACGG + Intronic
1083981076 11:66170645-66170667 TGGTAAAGGCTGGGTGGGCATGG + Intronic
1084541226 11:69788338-69788360 GGGTAGAGGGCGAGGGTGCAGGG + Intergenic
1084941306 11:72614824-72614846 GGGGAGAGGCTGGGGGTGGAAGG + Intronic
1085296164 11:75433003-75433025 GGGGCAAGGCTTAGGCTGCAGGG - Intergenic
1085397932 11:76216720-76216742 GGGTGAAGGCAGAAGCTGCAAGG - Intergenic
1086095882 11:83049453-83049475 GGGCAGAGGCGGGGGGTGCAGGG + Intronic
1088742942 11:112781521-112781543 GGGCAAAGGAACAGGGTGCAAGG + Intergenic
1089270773 11:117300121-117300143 GGGGAAAGGCTGGGGCTGGAAGG - Intronic
1089372602 11:117972015-117972037 GGCTAAAGCCCGAGTGTGCAGGG + Intergenic
1089605502 11:119638984-119639006 GGTTACAGGCTGAGAGTGCCCGG + Intronic
1089610844 11:119667729-119667751 GGGTCAAGGCTGAGGGTCCCAGG - Intronic
1089712157 11:120323351-120323373 GCCTAAAGGCTGAGGGGGTAAGG - Intergenic
1090655597 11:128841975-128841997 GGGTAAAGGATGTGTGTACAAGG - Intronic
1091291553 11:134443129-134443151 AGTTGAAGGCTGAGGGGGCAAGG - Intergenic
1091301508 11:134510792-134510814 GGGTGAAGGCTGGGTGAGCAGGG - Intergenic
1091715787 12:2775276-2775298 GGGAAAAGGCAGAAGGTTCAAGG - Intergenic
1093101947 12:15038321-15038343 GGGAGGAGGCTGTGGGTGCATGG + Intergenic
1093241614 12:16683808-16683830 GGGTCAAAGCTGAGGCTGGAAGG - Intergenic
1094288069 12:28816722-28816744 CGGTAAAGGCTCAGGGTCTAGGG - Intergenic
1094650415 12:32370499-32370521 GGGTAAGGGCTGGGGGTGCTTGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1100258865 12:92912707-92912729 GGGGAAAGGGTGAGGGTGGGAGG - Intronic
1100922062 12:99499377-99499399 GGGTAAAGACTTAGTTTGCATGG - Intronic
1101290119 12:103359914-103359936 GGGTTAAAGCTGAGGATTCAGGG - Intronic
1101441761 12:104709233-104709255 GGGGCGAGGCTGTGGGTGCAGGG - Intronic
1102150470 12:110686371-110686393 AGTTACATGCTGAGGGTGCAAGG + Intronic
1102391564 12:112553015-112553037 AGGTAAAAGGTGATGGTGCATGG - Intergenic
1102472581 12:113167964-113167986 GGGGCAAAGCTGAGAGTGCAAGG - Intronic
1102628155 12:114252939-114252961 GGGAAGAGGCAGAGGATGCAAGG - Intergenic
1103433357 12:120905969-120905991 GGGTGAAGGGTGGGGGTGGAGGG - Intergenic
1104570841 12:129924472-129924494 GGGTAAAGGCTGAGGACAGATGG - Intergenic
1104941055 12:132395476-132395498 AAGTAAAGGCTGGGTGTGCAGGG + Intergenic
1106175918 13:27331469-27331491 GGGTCAATGCTGAGGGCACAGGG - Intergenic
1106338853 13:28809310-28809332 GTGTTAAGTCTGTGGGTGCACGG + Intergenic
1107816857 13:44252185-44252207 GGGCAAAGGATGAGGGAGGATGG - Intergenic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1109865739 13:68260800-68260822 GGGTACAGGCTGAAGATGAATGG - Intergenic
1110221233 13:73076156-73076178 GGGTAAGGGGTGGGGGTGGAGGG + Exonic
1110257117 13:73444698-73444720 GGGTACAGACTGAAGGTGAATGG - Intergenic
1113433452 13:110270022-110270044 GGGTGAAGGCTGGGGGTGCGTGG - Intronic
1113467829 13:110524643-110524665 GTGTAAAGGAGGAGGGTGAAGGG - Intronic
1113591919 13:111507359-111507381 GGGTGGAGGCTGAGGCTGGAGGG - Intergenic
1113813826 13:113158439-113158461 AGGTAAAGGCAGCAGGTGCAAGG - Intergenic
1114221914 14:20704352-20704374 GGGAAAAGACTTAGGGTCCATGG - Intergenic
1114492484 14:23112139-23112161 GACTGAAGGCTGGGGGTGCAGGG - Intergenic
1116536257 14:46034776-46034798 GGGTAAAGGAGGAGGATCCAAGG + Intergenic
1118370100 14:65130479-65130501 GGGGTAGGGGTGAGGGTGCAGGG + Intergenic
1118503848 14:66389516-66389538 GGGAAAAGACTGAATGTGCAAGG + Intergenic
1118748243 14:68789470-68789492 GGGTATGGGATGTGGGTGCAGGG + Exonic
1118890170 14:69902531-69902553 GGGTGAAGGCAGAAGCTGCAAGG - Intronic
1118999674 14:70870974-70870996 GGGTAAAGACTGAAGATGAATGG + Intergenic
1119408516 14:74413214-74413236 TGGTAAAGGCTGAGTGTGGCTGG - Intronic
1119838364 14:77771341-77771363 GGGTGAAGGTTGAGGATGAAAGG + Intergenic
1120544427 14:85792852-85792874 AGGTAAAGACTGAGGCTGCAGGG + Intergenic
1120839419 14:89071143-89071165 GGGTAGAGGCAGTTGGTGCATGG + Intergenic
1122258669 14:100499632-100499654 GGGTGGTGGCTGAGGGAGCAGGG + Intronic
1124880586 15:33639044-33639066 GGGTAAAGTCCAAGGGTGCTTGG - Intronic
1126258096 15:46651890-46651912 GGGTATGGGAGGAGGGTGCAGGG + Intergenic
1127166084 15:56245299-56245321 GGGTTGAGGGTGGGGGTGCAGGG + Intronic
1128104570 15:65033879-65033901 GGGTAAAGGGTGAGGAAGCAAGG - Intergenic
1129107565 15:73320103-73320125 GGGTGAAGGTGGAGGGTCCAGGG - Exonic
1129687668 15:77695802-77695824 GGGGACAGGCTGATGGTGCTGGG - Intronic
1130990292 15:88871978-88872000 GGGGAAAGGGTGAGGGTGTCAGG - Intronic
1131111334 15:89766940-89766962 GGGGAAAGCCGCAGGGTGCAGGG + Intronic
1131289907 15:91098741-91098763 GGGGAAAAGATGAGGGTGGAGGG + Intergenic
1131365725 15:91837595-91837617 GGGTACAGGATAAGGGAGCATGG + Intergenic
1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG + Intronic
1135487570 16:22879464-22879486 GGATAAAGGCAGAGGGTGGATGG + Intronic
1136631774 16:31493171-31493193 GGGTAATGGCTGAGGGAGAGAGG - Intronic
1137270964 16:46901955-46901977 GGGGCCAGGCAGAGGGTGCAGGG - Intronic
1138443959 16:57051709-57051731 GGGTAAAGGCGGGGGGTTGAGGG - Intronic
1138481410 16:57305745-57305767 GGCCAAAGGCTTAGGGGGCATGG - Intergenic
1138807538 16:60108255-60108277 GGGAAACGGGTGAGGGGGCAGGG + Intergenic
1139015096 16:62680010-62680032 AAGAAAAGGCTGAGGGTGGATGG + Intergenic
1139340019 16:66262456-66262478 GGGAGAAGGCTGAGGGTACTGGG - Intergenic
1141623772 16:85250800-85250822 GAGTGACGGCTGAGGATGCAGGG - Intergenic
1142270956 16:89088966-89088988 CGGGAAAGGCTGGGGGTGGACGG + Intronic
1142321534 16:89386388-89386410 GGGTAAAGGGTGGGGCAGCAGGG - Intronic
1142871839 17:2826328-2826350 GGGCAAAGGCTGCGGGTGGGTGG + Intronic
1146185981 17:30724536-30724558 GGGGACAGGCTGAGGCTGCAGGG + Intergenic
1147421333 17:40323535-40323557 GGGTGCAGGCTGTGTGTGCAGGG - Intronic
1148113701 17:45162272-45162294 GGGAGAAGGTTGGGGGTGCAGGG + Intronic
1148858370 17:50591385-50591407 GGGGAGAGGGTGAAGGTGCAGGG + Intronic
1149577380 17:57723880-57723902 GGCTGAAGCCTGAGAGTGCAGGG + Intergenic
1149985871 17:61346654-61346676 GGTTAAAGGCTCAGGCTTCAAGG - Intronic
1150004694 17:61462530-61462552 GGGCATAGGGAGAGGGTGCAGGG + Intronic
1150817618 17:68406031-68406053 GGGTAAAGTGGGAGGGGGCAAGG - Intronic
1151579761 17:74971475-74971497 GGGAAAGGGGTGAGGGAGCAAGG + Intronic
1152075840 17:78159043-78159065 GGGTAAAGCCCGTGGGGGCAGGG - Intronic
1152223415 17:79081731-79081753 GGGGAAAGGCTGAGGCTGTGTGG + Intronic
1152223448 17:79081812-79081834 GGGGAAAGGCTGAGACTGCAGGG + Intronic
1154464582 18:14631517-14631539 GAGTAGAGGCTGAGGGTCCAGGG - Intergenic
1156520681 18:37720118-37720140 CAGTAAATGCTGAGGGTGCCTGG - Intergenic
1157602252 18:48901514-48901536 GGGTAGAGGCTGAGGTAGGAAGG - Intergenic
1158557160 18:58484970-58484992 GGGTAGGGGCAGAGGGTGCCTGG + Intronic
1160557244 18:79734175-79734197 GGGTAATGTCTGAGCGTGGAAGG + Intronic
1160584071 18:79903191-79903213 GGGCAATGGCTGAGGGGGCCGGG - Exonic
1160925674 19:1544015-1544037 GGGTTAGGGATGAGGGTGCGGGG + Intergenic
1161620979 19:5296924-5296946 GGGTAGAGGATGAGGGAGAAAGG + Intronic
1162972796 19:14191195-14191217 GGGGACAGGCTGAGGCTGGAGGG - Intronic
1162978348 19:14221843-14221865 GGGGCACGGCTGGGGGTGCAGGG + Intergenic
1163361272 19:16847642-16847664 GGAGAAAGGCTGACTGTGCAGGG - Intronic
1165014570 19:32871170-32871192 GGGTAGTGGGTGAGGTTGCAGGG - Intergenic
1165430088 19:35767407-35767429 GGGTGGAGGCTGGGGGTGCAAGG - Intronic
1165430105 19:35767449-35767471 GGGTGGAGGCTGGAGGTGCAGGG - Intronic
1165473438 19:36016268-36016290 GGGGAAAGGCTGGGGGTGATGGG - Intronic
1165810141 19:38607114-38607136 GGGATGTGGCTGAGGGTGCAGGG + Intronic
1165898957 19:39159725-39159747 AGGTGAAGGTTGAGGGGGCAGGG + Intronic
1165999630 19:39870679-39870701 GGGCAAAGGCAGAGGGGTCAGGG + Intronic
1165999723 19:39870950-39870972 GGGCAAAGGCAGAGGGGTCAGGG + Intronic
1166423162 19:42653775-42653797 GGCTGAATGCTGAGGGTCCAGGG + Intronic
1166831960 19:45644623-45644645 GGGAAAAGGCTGAGGATGGGGGG - Intronic
1167756382 19:51415965-51415987 GGGTGAAGGCTGGGGATTCAGGG - Exonic
925552932 2:5095716-5095738 GGGTAAAGGCAGAGGATGCTTGG + Intergenic
925736340 2:6967387-6967409 GGGAAGAGGATGAGGGTGAAGGG + Intronic
926122794 2:10254014-10254036 GGGAAGAGGCTGTGGGTGCTTGG + Intergenic
926445788 2:12941381-12941403 ATGCAAAGGATGAGGGTGCATGG + Intergenic
926607842 2:14915306-14915328 GGTTAAAGGCTGAGGATCTAAGG + Intergenic
927033461 2:19147394-19147416 GGATAAAGTCTGAGGATACAGGG - Intergenic
928112481 2:28521951-28521973 GGGAAGGGGCTGAGGTTGCAGGG - Intronic
929046843 2:37798641-37798663 GGAAAAAGGCAGAGGGTGGAAGG - Intergenic
929870856 2:45758071-45758093 CAGAGAAGGCTGAGGGTGCAAGG + Intronic
931284419 2:60820233-60820255 GCGGAAAGGCAGAGGGTCCACGG - Intergenic
933759620 2:85664767-85664789 TGGGAAAGGCTGAGGGGGCAGGG + Intronic
934766008 2:96880392-96880414 GGGAACAGGCTGGGGGTGCCTGG + Intronic
935581599 2:104760565-104760587 AAGGAAAGGCTGAGGGTACAAGG - Intergenic
936092355 2:109509694-109509716 GTGAGAAGGGTGAGGGTGCAGGG - Intergenic
937993179 2:127675224-127675246 AGGTCAAGGCTGAGGGTGGTGGG + Intronic
938018097 2:127884995-127885017 GGGATAAGGGTGAGGGAGCATGG + Intronic
938138398 2:128777304-128777326 GGGCACAGGATGGGGGTGCAGGG + Intergenic
939047050 2:137262028-137262050 CTGTAAAAGCTGAGGATGCAAGG + Intronic
940007938 2:149026166-149026188 TGGGAAAGGCAGAGGGTGGAGGG + Exonic
940131831 2:150390363-150390385 GTGCCAAGCCTGAGGGTGCAGGG - Intergenic
940724774 2:157324455-157324477 TGTTCAAGGCTGAGGCTGCATGG - Intronic
946337837 2:219050159-219050181 GGCTCTAGGCTGAGGGAGCAGGG + Intergenic
947179351 2:227398435-227398457 GGACAAAAGCTGTGGGTGCAGGG - Intergenic
947829283 2:233127201-233127223 GGGCATGGGCTGAGGGTTCATGG + Intronic
947871535 2:233441415-233441437 GTGCCAAGACTGAGGGTGCAGGG + Intronic
948903069 2:240965859-240965881 TGGCCCAGGCTGAGGGTGCAAGG + Intronic
1169254779 20:4088700-4088722 GCATAAAGGCTGGGGGTGGAGGG - Intergenic
1170587110 20:17743057-17743079 TGGTAAAGGGTGTGGGTACAAGG - Intergenic
1171338837 20:24411286-24411308 GAGTAAAGGCTCAGGAAGCACGG - Intergenic
1172034384 20:32001064-32001086 GGATAAGGGCTGAGGGAGCTGGG + Exonic
1172190571 20:33059732-33059754 GGGTCAGGGAAGAGGGTGCAGGG + Intronic
1172776138 20:37408111-37408133 AAGGAAAGGCTGAGGGGGCATGG - Intergenic
1173092383 20:39985582-39985604 GGGAAGAGGCTGAGGAGGCAAGG - Intergenic
1173845111 20:46183243-46183265 GGGAAAAGGCTGAGGCAGCAGGG - Intronic
1175534003 20:59694821-59694843 GGGGAAATGCTGTGGGTCCAAGG + Intronic
1175885597 20:62288601-62288623 GGCCGAAGGCTGTGGGTGCAGGG + Intronic
1175934546 20:62509054-62509076 GGTGAAAGGGTGAGGGTGGAGGG - Intergenic
1176284659 21:5012962-5012984 GGGTGGAGACTGAGGGGGCAGGG - Intergenic
1176809957 21:13526867-13526889 GAGTAGAGGCTGAGGGTCCAGGG + Intergenic
1176882805 21:14216986-14217008 GGGCAAATACTGAGGGTGCTGGG + Intronic
1177447523 21:21217078-21217100 GGATAAATGCTGAGGGTGCCAGG + Intronic
1179521527 21:41948570-41948592 GGGTCACGGTGGAGGGTGCAGGG + Intronic
1179559200 21:42202085-42202107 GGGTAAACGCTGCTGCTGCATGG - Intronic
1179872522 21:44250513-44250535 GGGTGGAGACTGAGGGGGCAGGG + Intronic
1180054729 21:45351878-45351900 GGGCACGGGCTGAGGATGCAGGG + Intergenic
1180741643 22:18057188-18057210 GGGGAAAGGCTGTGGGCTCAAGG + Intergenic
1182042712 22:27250807-27250829 GAGTACAGGCTAAGGGTGCAAGG + Intergenic
1182329973 22:29544616-29544638 GGATAAAGGCTCTGTGTGCATGG + Intronic
1182709662 22:32312622-32312644 GGGTAGGGGCTGGGGGTGCAGGG - Intergenic
1182835783 22:33340386-33340408 GGGTGGAGGCAGAGGGTCCAAGG + Intronic
1183686191 22:39362630-39362652 GGGGAAAGGCTGAGGGAAGAAGG - Intronic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
1184397219 22:44249478-44249500 GGGTAGGGGCTGGGGGTGCAGGG - Exonic
1184544199 22:45155098-45155120 GGGTAGAGGCTAAGCATGCAGGG - Intergenic
1184920217 22:47600655-47600677 GTGCAGAGGCTGAGGGGGCAGGG - Intergenic
1185047855 22:48537876-48537898 GGGATCAGGCTGAGGGTGTAGGG + Intronic
1185186922 22:49406885-49406907 GGGTAAAGGCTGGGGGTGTCAGG + Intergenic
1185320783 22:50199439-50199461 GGGTCCAGGCTGGGGCTGCACGG - Exonic
951396136 3:22169027-22169049 AGGTGAAATCTGAGGGTGCAAGG + Intronic
953250194 3:41238844-41238866 GGGTAAATGCAGAGTGTTCAGGG + Intronic
953856565 3:46503799-46503821 AGGGAAAGGGGGAGGGTGCAGGG - Intergenic
954131218 3:48561960-48561982 GGGTCGAGGCTGGGGATGCAGGG + Exonic
954148467 3:48645934-48645956 TGGGAAGGGCTGAGGGTGCCTGG + Intronic
954673594 3:52303648-52303670 GAGGAAAGGCTGAGGGAGCCAGG - Intergenic
954921943 3:54198762-54198784 GGCTAAAGCCTGGGGCTGCAAGG - Intronic
957115618 3:76020959-76020981 AAGTAAAGGATGTGGGTGCAAGG - Intronic
960219890 3:115094028-115094050 GGGATAAAGCTGAGGGTACAGGG - Intronic
960378532 3:116932391-116932413 TGGAAAAGGCTGAGGGTGGGAGG - Intronic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
961589985 3:127971648-127971670 GGGAGCAGGCTGAGGGAGCAGGG + Intronic
962080560 3:132135058-132135080 AGGAAGAGGCTGTGGGTGCAGGG - Intronic
962104693 3:132378709-132378731 GGGTAAAGGGTGGGGGTGGATGG - Intergenic
964050889 3:152391932-152391954 TGGGAAAGGCTGAGTTTGCAGGG + Intronic
964624889 3:158749351-158749373 GGGGAAAGGGTGAGGCTGAATGG - Intronic
965155076 3:165041397-165041419 TGATAAAGGCTGTGGGTACAAGG - Intronic
965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG + Intronic
965695412 3:171403087-171403109 GGGAAAAGGATGACGGTGAAAGG + Intronic
966466078 3:180232630-180232652 GGGTACAGGCTGAAGATGGATGG - Intergenic
967478175 3:189944711-189944733 GGGCAAAGGGGGAGGGTGGAAGG - Intergenic
968505993 4:971760-971782 GGGCAAAGGCTGCGGGGGCTGGG + Intronic
968637979 4:1692212-1692234 GGGTGAAGGCAGTGGGAGCAGGG + Intergenic
969145003 4:5114894-5114916 GGGAAGAGGCTTGGGGTGCAGGG - Intronic
971379424 4:26083426-26083448 GGGAAGAGGCTGTGGGGGCACGG + Intergenic
972140129 4:35948377-35948399 GGTTGAAGACTGAGGCTGCAGGG - Intronic
974055542 4:56979160-56979182 AGGGAGAGGCGGAGGGTGCAGGG + Intronic
974963834 4:68736045-68736067 GGGTACAGACTGAAGGTGAATGG + Intergenic
977252066 4:94700591-94700613 TGGGAATGGCTGTGGGTGCATGG - Intergenic
979746216 4:124216565-124216587 TGGTCAAGGCTGAGGATGCATGG - Intergenic
981515589 4:145605500-145605522 GGGTAAAGGCTGAGGCAGGCAGG - Intergenic
982132219 4:152239765-152239787 GGGAAAATGCTTAGGGTGAAGGG + Intergenic
982899778 4:160983413-160983435 GGGTTAGGGTTGAGGGTGGAAGG - Intergenic
985721436 5:1491488-1491510 GGGTAAATGTGGGGGGTGCAGGG + Intronic
985809884 5:2075188-2075210 GGGAAAAGGCTGCGAGTGCAGGG + Intergenic
985869782 5:2545181-2545203 TGGTACAGTCTGAGTGTGCAGGG + Intergenic
987092691 5:14522052-14522074 GGGTCAAGACTGGGGGTGCAGGG - Intronic
991292345 5:65045020-65045042 GAGTAAAGGGTGATGGTGGATGG - Intergenic
991648045 5:68821108-68821130 GGCAAAAGGGTGAAGGTGCAAGG - Intergenic
992003381 5:72456123-72456145 GGGAAAGGTCTGAGGGTGGAAGG - Intronic
993310388 5:86323554-86323576 GGGTAAAGGTGGAGCGGGCAGGG + Intergenic
993499532 5:88649526-88649548 GGGGAAAGGGTGGGGGGGCAAGG + Intergenic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
997235243 5:132268690-132268712 GAGGACAGGCTGAGTGTGCAAGG - Intronic
997466352 5:134090580-134090602 GGGTGGAGGCTGAGGGTGGGAGG - Intergenic
998632830 5:143919110-143919132 GGGGAAAGGCTGGGGGTGGAGGG + Intergenic
999231631 5:150065368-150065390 GGGAAATGGCTGAGGCAGCAGGG - Intronic
999486854 5:152005320-152005342 GGGTAAAGGCTGATTTTGCCGGG - Intergenic
1000385576 5:160671906-160671928 GTGGGAAGGCTGAGGCTGCAGGG - Intronic
1001288101 5:170438215-170438237 GGGTCCAGGCTGAGGGAGAAGGG - Intronic
1001290320 5:170452686-170452708 GGATAAAGGCAGAGGGAGCAGGG - Intronic
1003486187 6:6581658-6581680 GGGGAAAGGCTGAGGGGAGAGGG - Intergenic
1003521637 6:6863227-6863249 GGGTGAGAGCTGAGGGTGAAGGG - Intergenic
1005686282 6:28255813-28255835 GGGTAAAGGCTGGGGGTAGTTGG + Intergenic
1006579602 6:35069147-35069169 GGGAAAAGGCAGAGGGCCCAGGG - Intronic
1006618104 6:35343189-35343211 GAGTAAAGCCTGAGAGAGCAAGG - Intronic
1007717182 6:43864157-43864179 GGGTGAAGGGTGAGGCTGCAGGG - Intergenic
1011899126 6:92270485-92270507 GGGTAAAGGTGGAAGTTGCAAGG + Intergenic
1012221660 6:96657133-96657155 GAGAAAATGCTGAGGGTGGATGG + Intergenic
1012804675 6:103879001-103879023 GGGTACAGGCTGAAGATGAATGG - Intergenic
1013990593 6:116250841-116250863 GGGAAAAGGGTGATGGTGGATGG + Exonic
1014825771 6:126047267-126047289 GGGTACAGGATAAGGGGGCATGG - Intergenic
1016997562 6:149970962-149970984 GAGGAAAGGCTGAGAGTGAAGGG + Intronic
1017001238 6:149999214-149999236 GAGGAAAGGCTGAGAGTGAAGGG - Intergenic
1017327063 6:153151906-153151928 TGGTAAAGGCTCAGGGTCTAGGG - Intergenic
1018895254 6:168012340-168012362 GAGGAAAGACTTAGGGTGCATGG + Intronic
1019365471 7:630419-630441 GGGTCCTGGCTGGGGGTGCAAGG + Intronic
1020181021 7:5922512-5922534 GGGTGGACACTGAGGGTGCAGGG + Intronic
1020301912 7:6802376-6802398 GGGTGGACACTGAGGGTGCAGGG - Intronic
1020956033 7:14740751-14740773 GGGGAAAGGCAGTGAGTGCACGG + Intronic
1021819981 7:24487199-24487221 TGGTGGAGGCTGAGGGTGGAGGG - Intergenic
1022522595 7:31017668-31017690 GGGTAAAGAGTGAGGGTCCCAGG + Intergenic
1023225062 7:37960557-37960579 AAGCAAAGGCTGAGGCTGCAAGG + Intronic
1023351396 7:39323498-39323520 AGGTAGAAGCTGATGGTGCATGG - Intronic
1023965397 7:44961235-44961257 GGGTAAGGGCTGAGGGCTGAGGG + Intergenic
1024375804 7:48636756-48636778 GGGAAACAGCTGAGGATGCAGGG - Intronic
1027648660 7:80837441-80837463 GGGTAAATGCTGCAGCTGCAAGG + Intronic
1027930691 7:84530633-84530655 AGGTAATGTCTGAGTGTGCAGGG - Intergenic
1028910989 7:96207375-96207397 GGGTAGAGGTGGAGGGTGCACGG - Intronic
1029407353 7:100383494-100383516 GGGAAGAGGCAGAGGGTGGAAGG + Intronic
1029435723 7:100563005-100563027 GGGTTAAGGGAGAGGCTGCAGGG - Intronic
1030070531 7:105693983-105694005 GGGGAAAGGAGGAGGGTGGAAGG + Intronic
1032269022 7:130387110-130387132 GGTAGAAGGCTGAGGGGGCAGGG + Intronic
1032462964 7:132125629-132125651 AGGAAGAGGCTGAGGGTTCAAGG + Exonic
1034628087 7:152509487-152509509 GGGTAAAGGCAAAGGTGGCAAGG + Intergenic
1034936833 7:155205390-155205412 GGCTATTGGCTGAGGGAGCAGGG - Intergenic
1036674454 8:10818575-10818597 GGGCAAAGGCTGGGGGTGGTGGG + Intronic
1037585909 8:20275750-20275772 TGGGGAAGGGTGAGGGTGCAGGG + Intronic
1038530119 8:28311803-28311825 GGTTCAGGGCTGAGGGTGGAAGG + Intergenic
1039884076 8:41645656-41645678 GGGGAAAAGGGGAGGGTGCAGGG - Exonic
1040983860 8:53272091-53272113 GGGAAAAGGCGAAGGGTCCATGG - Intergenic
1043060376 8:75492868-75492890 GGGAAAAGGCAGAGAGTGCTTGG - Intronic
1045359054 8:101415155-101415177 GGGGAGAGGCTGAGAGTGCAAGG - Intergenic
1045790081 8:105973202-105973224 GGGTAGAGGATGAGGGCTCAAGG - Intergenic
1048256261 8:132907289-132907311 GGGGAGAGGCTGATGGGGCAGGG - Intronic
1048961181 8:139579682-139579704 AGGTAAAGGCTGAGGAAGAATGG - Intergenic
1049292684 8:141812914-141812936 GGGTCAGGGGTGAGGGTGCTGGG - Intergenic
1049292702 8:141812958-141812980 GGGTCAGGGATGAGGGTGCTGGG - Intergenic
1049292767 8:141813143-141813165 GGGTCAGGGATGAGGGTGCTGGG - Intergenic
1049293000 8:141813779-141813801 GGGTCAGGGATGAGGGTGCTGGG - Intergenic
1049494258 8:142922388-142922410 GGGTCTAGGCTGAGGGTCCCTGG - Intergenic
1049530753 8:143153688-143153710 GGCCAAGGGCTGAGGGTCCAGGG - Intergenic
1049548759 8:143246777-143246799 GGGTGAAGCCTGAGGGGGCGGGG + Intergenic
1049583666 8:143423459-143423481 GTGTAATCCCTGAGGGTGCACGG - Intronic
1050077713 9:1882101-1882123 TGGCCAAGGCTGAGGGAGCAGGG - Intergenic
1050108591 9:2191476-2191498 GCGAAAAGGCTGAAGGGGCATGG - Intronic
1050691709 9:8234554-8234576 GGGCACAGGCTGAGGGAGAAGGG + Intergenic
1051181661 9:14418204-14418226 GGGTTGAGGGTGGGGGTGCAGGG - Intergenic
1052840784 9:33289605-33289627 GGGGAAAGGTGGAGGGTGAACGG - Intergenic
1053285208 9:36845738-36845760 GGGTCAAGGCTGAGATTACATGG + Intronic
1053434306 9:38065424-38065446 GGGAAATGGCTGAGGGTCCTGGG - Intronic
1057861651 9:98645490-98645512 GAGGAAAGGCTGAAGGTGCAGGG - Intronic
1059428322 9:114235217-114235239 GGGTGAAGGCAGCGTGTGCAAGG - Intronic
1059762415 9:117351041-117351063 GTGTAGACGTTGAGGGTGCAAGG - Intronic
1060213204 9:121723098-121723120 GACTAAAGGCTGTGGGTGCTGGG - Intronic
1060408885 9:123386879-123386901 GGGAACAGGGAGAGGGTGCAGGG + Intronic
1060918896 9:127406751-127406773 GGGCCAAAGCTGAGGGTGGAGGG + Intronic
1061413336 9:130432554-130432576 GGGTAAGGGCTGAGTTGGCAGGG + Exonic
1189423698 X:40879851-40879873 TGGTAAAGCCTGAGGGTGTGTGG + Intergenic
1190912650 X:54786997-54787019 GGGTAAGGGCTCACGGTGCATGG + Intronic
1190952678 X:55161732-55161754 GGCTAAAGGCTGTGGATGCTGGG - Intronic
1190989843 X:55535934-55535956 GGGTAAATGCTGAGGGTGGGTGG + Intergenic
1192260654 X:69504430-69504452 GGCGACAGACTGAGGGTGCATGG + Intergenic
1192449558 X:71235424-71235446 GTGGAAAGGCTGAGGGTGGTGGG - Intergenic
1194657665 X:96592869-96592891 GGGTAAGACCTGAGGGTGGAAGG - Intergenic
1195255101 X:103082416-103082438 GGGAGGAGACTGAGGGTGCAGGG - Intronic
1195678923 X:107529214-107529236 GGGCAAAGGGTGAGGGTAGAGGG - Intronic
1197171837 X:123443487-123443509 AGGTAAAGGCTGTGGGTAAAAGG + Intronic
1197753129 X:129979480-129979502 GGGTAAAGGGTAAGGGTCAAGGG + Intergenic
1197805524 X:130394915-130394937 GGGTAAAAGCTGCCCGTGCAAGG + Intergenic
1199169757 X:144721993-144722015 GGGTACAGACTGAAGATGCATGG - Intergenic
1200007565 X:153097922-153097944 GGGTAAAGACTTAGGGTCTATGG + Intergenic
1200148445 X:153939669-153939691 GGATAAAGGCAGAGTGGGCAAGG - Intronic