ID: 1132907042

View in Genome Browser
Species Human (GRCh38)
Location 16:2288007-2288029
Sequence CTCGGTAAGGGGCATCCCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132907042 Original CRISPR CTCGGTAAGGGGCATCCCGG GGG (reversed) Exonic