ID: 1132909488

View in Genome Browser
Species Human (GRCh38)
Location 16:2301339-2301361
Sequence CAGTGTCATCTTACAGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132909486_1132909488 -6 Left 1132909486 16:2301322-2301344 CCATTACCTCTAACGGTCAGTGT 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1132909488 16:2301339-2301361 CAGTGTCATCTTACAGTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132909488 Original CRISPR CAGTGTCATCTTACAGTTGA TGG Intronic
900635521 1:3663014-3663036 CAGTGGCATCATACAGATGAGGG + Intronic
902311090 1:15582375-15582397 CATTCCCATCTTACAGGTGAGGG + Intronic
902701412 1:18174995-18175017 CACTGCCATCTTGCAGATGATGG + Intronic
904191071 1:28744090-28744112 CAGTATCACCTAACAGTTCAAGG + Intronic
906069013 1:43004009-43004031 CAGTGTGCACTTACAGTAGAAGG - Intergenic
906630463 1:47362993-47363015 CAGTGTATTCTTACAGTCAAAGG + Intronic
906949258 1:50321172-50321194 CAGTGTCATGTCACAATTAAGGG - Intergenic
907542813 1:55231819-55231841 CATTGTCATCTTACAAATAAAGG + Intergenic
908217368 1:61967489-61967511 CAGTTTCATCTTACCTTTTAAGG + Intronic
912783700 1:112578069-112578091 TAGTCTCATTTTACAGATGAAGG + Intronic
913178188 1:116294294-116294316 GACTCTCATCTTACAGATGAGGG - Intergenic
919515678 1:198519575-198519597 CATGGTCATCTTCCTGTTGAAGG + Intergenic
921422720 1:214967066-214967088 CAGTGTCATCTCATGGTGGAAGG + Intergenic
922046126 1:221948076-221948098 CAGTGGAAAGTTACAGTTGAAGG - Intergenic
922047298 1:221958463-221958485 CAGTGGAAAGTTACAGTTGAAGG - Intergenic
1063521852 10:6748461-6748483 CTTTGTCATCCTTCAGTTGACGG + Intergenic
1063850172 10:10179945-10179967 CAGTGCAATGTTACAATTGATGG - Intergenic
1067280765 10:44870477-44870499 CTGTGTCCTCATACAGTAGAAGG + Intergenic
1070168740 10:73916635-73916657 CAGTCTCTTCTTACAGCTGATGG - Exonic
1071867070 10:89746448-89746470 CCGTGTCATCTCACAGTAGATGG + Intronic
1072000139 10:91186861-91186883 CAGTGTAATCTTCAAGGTGAGGG + Intronic
1072435063 10:95407250-95407272 CATTGTCATCTGAAAGTTGCTGG - Intronic
1072995648 10:100241383-100241405 CAATTTCATCTTACACTTTAAGG - Intronic
1078402981 11:11044498-11044520 CATCCTCATTTTACAGTTGAGGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080549292 11:33357330-33357352 CAGGGTCATCTTATGGTTGCAGG - Intergenic
1082069639 11:47928578-47928600 CAGTGTCACCTTACAAGTCAGGG - Intergenic
1082785855 11:57316194-57316216 CAGTGGCATCTGACAGCTGATGG + Intronic
1086796164 11:91105701-91105723 CATTCTCATTTTACAGTTGATGG + Intergenic
1087431647 11:98063909-98063931 CAGTATCAGAATACAGTTGATGG + Intergenic
1087712442 11:101568926-101568948 CAGTTTCTTCTTAGCGTTGATGG - Intronic
1091036926 11:132243023-132243045 CAGCGTCTTCTTAAAATTGAGGG - Intronic
1093903723 12:24664638-24664660 CTGTGTCATCCCACAGTGGAAGG - Intergenic
1097423754 12:59415366-59415388 CAGTTTCATTTTATTGTTGAAGG - Intergenic
1097876228 12:64646588-64646610 CAATGTTAACTTACAGTAGATGG - Intronic
1099692478 12:85975911-85975933 CAGTGCCATCTAACAATTGAAGG - Exonic
1099825580 12:87773184-87773206 CAGTGTCTACTTAAAGTTGGAGG - Intergenic
1100100132 12:91092596-91092618 CAGTGGGATATTTCAGTTGAAGG + Intergenic
1100962707 12:99981703-99981725 CATTGTCATTTCACAGATGAAGG - Intronic
1103767817 12:123294381-123294403 CAATGCCATCTTACATTTTAGGG + Exonic
1106043187 13:26113439-26113461 CAGTGCCATATTAGAGTTGCTGG - Intergenic
1107010165 13:35662404-35662426 CACTGTCACATCACAGTTGATGG - Intronic
1108067238 13:46590694-46590716 AAGTCTCATCTTAAATTTGATGG + Intronic
1110968992 13:81737758-81737780 CAGTGTCATATAACAATGGACGG + Intergenic
1111900266 13:94191399-94191421 CAGTGTCAAGTTTGAGTTGAAGG + Intronic
1112117946 13:96378034-96378056 TAGTGTCATCTGACAGTTTTGGG + Intronic
1112291828 13:98150417-98150439 TAATGTCATCTTATAGTTGTAGG + Intronic
1117169655 14:53080500-53080522 CATTTTCAACTTACAGATGAAGG - Intronic
1119009190 14:70965931-70965953 CAGTATCTTTTTACACTTGAGGG - Intronic
1121071757 14:91029619-91029641 CAGTCTTATTTTACAGATGAGGG - Intronic
1121822210 14:96980606-96980628 CAGTGTGATGTGACAGTTGGTGG + Intergenic
1122937813 14:104967992-104968014 CAGTGTCATGATTCAGGTGATGG - Intronic
1124889082 15:33715150-33715172 AAGTGTCATCTTAGCTTTGAAGG + Intronic
1125364799 15:38902368-38902390 CAGTCTCCTCTTGGAGTTGAAGG + Intergenic
1125460228 15:39899286-39899308 CAGTTTCAGCTTCCAGTTCAAGG + Intronic
1126664012 15:51059431-51059453 AAATGGCATCTTACAATTGATGG + Intronic
1130024235 15:80257493-80257515 CAGAGTCATCATTCAGTTAACGG + Intergenic
1132883962 16:2174270-2174292 CAGTGTCTTCTGACACTTGTAGG - Exonic
1132909488 16:2301339-2301361 CAGTGTCATCTTACAGTTGATGG + Intronic
1133554212 16:6889383-6889405 CAGTGATATCTTACATATGACGG + Intronic
1135038794 16:19101552-19101574 GAGTCTCATCTTACAGGTCAGGG - Intergenic
1136468644 16:30463302-30463324 CTGTGTCATCCCACAGTAGAAGG - Intergenic
1137042599 16:35627101-35627123 TATTGTCATCTTAGATTTGATGG - Intergenic
1138564176 16:57820579-57820601 CAGAGTGATCTTAGAGTTGATGG + Intronic
1143249988 17:5516156-5516178 CAGTGTGATCTCACAGTTCAGGG + Intronic
1144082692 17:11779033-11779055 CACTGCCATCTTATACTTGAAGG - Intronic
1144836718 17:18160213-18160235 CACTGTCATTTTACAGATGAGGG - Intronic
1147302634 17:39542014-39542036 AAGGGTCATCTTAAAGTTGGGGG - Intronic
1147568104 17:41549919-41549941 CACTGTCATCTGAGAATTGAGGG + Intergenic
1149346473 17:55741567-55741589 CACTTTCATTTTACAGATGAGGG - Intergenic
1150336726 17:64335703-64335725 CAAGATCATCTAACAGTTGATGG - Intronic
1152399774 17:80058890-80058912 CAATGTCTTCTTCCAGTTGCTGG - Exonic
1155094932 18:22546491-22546513 CAATATCATTTTACATTTGAGGG + Intergenic
1155521712 18:26674992-26675014 ACGTTACATCTTACAGTTGACGG - Intergenic
1155717711 18:28967867-28967889 CAATGTCATCTCACACTGGATGG + Intergenic
1157784726 18:50471257-50471279 CTGAGACATCTTACAGTTGATGG - Intergenic
1157797332 18:50587285-50587307 CTGTGTCCTCTCACAGTGGAAGG - Intronic
1158507060 18:58056274-58056296 AAGTGACAGCTGACAGTTGATGG + Intronic
1159116988 18:64125910-64125932 CTGTGTGATCTCACAGTAGAGGG - Intergenic
1159563334 18:70019691-70019713 GAGTGTCATCTTAAATTTGCAGG - Intronic
1163688201 19:18724287-18724309 CATTTTCATCTTAGAGGTGATGG + Intronic
925091602 2:1160945-1160967 CAGAGTCATTTTACAGGTGTTGG + Intronic
930086094 2:47498300-47498322 CAGTGTGGTCTTGCAGTTGTGGG - Intronic
933973663 2:87490564-87490586 CACTCTCATTTTACAGGTGAAGG - Intergenic
935647174 2:105348170-105348192 CCCTGTCCTCTTACATTTGAGGG + Exonic
936166039 2:110120445-110120467 CAGTGTCCTCTGCCAGTTGAGGG - Intergenic
936320064 2:111459649-111459671 CACTCTCATTTTACAGGTGAAGG + Intergenic
936430770 2:112460558-112460580 CAGAGTCAGCTAACAGTTGCTGG - Intergenic
937331196 2:121031413-121031435 CAGTGTCATCGCAAAGGTGATGG + Intergenic
938952614 2:136269309-136269331 CAGTTTCTTCCTACTGTTGATGG + Intergenic
942533182 2:176934669-176934691 CAGTGACATGTAACAGTAGACGG - Intergenic
942677920 2:178448343-178448365 CTGTGTCTTCTTACACTTGAGGG - Intronic
943971816 2:194419377-194419399 CAGTGTCCTCACACAGTGGAAGG - Intergenic
943973536 2:194441786-194441808 CAGTTTCTTCATACTGTTGATGG - Intergenic
944776454 2:202971240-202971262 CACTGTGGTCCTACAGTTGAGGG - Intronic
945773537 2:214076930-214076952 CAGAGTCATCTTATATATGATGG + Intronic
945938826 2:215928134-215928156 CATTGCCATTTTACAGATGAAGG + Intergenic
948387193 2:237588274-237588296 CTGTGTCATCCCACAGTGGAAGG - Intronic
1172319725 20:33986900-33986922 CAGTTTCACCTTGCAGGTGAAGG - Intergenic
1173366450 20:42389932-42389954 CTGTGTCATCTTATGGTAGAAGG - Intronic
1174129017 20:48328685-48328707 CAGTGTCCCCTTTCAGTTGGTGG - Intergenic
1174927923 20:54781353-54781375 AAGTGTCATCTTAGACTTGTTGG - Intergenic
1178290720 21:31365782-31365804 CAGTGAAATCTTGCAGTTGTTGG - Intronic
1181445429 22:22969076-22969098 CAGTTTCTTCATACCGTTGATGG - Intergenic
1181886318 22:26024966-26024988 CTGTGTCATCACACAGTGGAAGG + Intronic
1182012359 22:27011504-27011526 TACTGGCATCTAACAGTTGAGGG - Intergenic
1182133877 22:27882431-27882453 CAGTGTCCTGTTTTAGTTGAGGG - Intronic
1183641953 22:39098121-39098143 CATTCTCATCTTACAGAGGAGGG - Intronic
949440360 3:4073398-4073420 CAGTTTCTTCATAGAGTTGATGG - Intronic
950178317 3:10892525-10892547 CACTCTCATTTTACAGCTGATGG - Intronic
950403557 3:12789821-12789843 CAGTGTCCTATTTCTGTTGAAGG - Intergenic
951315559 3:21185852-21185874 CAGTGGAAAGTTACAGTTGAAGG + Intergenic
951741903 3:25933553-25933575 CAGTTTCTTCATACTGTTGATGG - Intergenic
951775594 3:26307121-26307143 CAGTGGAAAGTTACAGTTGAAGG + Intergenic
953619751 3:44522907-44522929 CAGTGGAAAGTTACAGTTGAAGG - Intergenic
954061005 3:48067253-48067275 CACTCTCATTTTACAGTAGAGGG + Intronic
954884241 3:53857988-53858010 CAGCTTCATCTTGCAGTTAAAGG - Intronic
955941222 3:64148737-64148759 CAGAGTCATCATATAGTGGAAGG - Intronic
957192415 3:77026691-77026713 CTGTGTCATTTTACAGATAATGG + Intronic
957597242 3:82283200-82283222 CAGTGTGACCTTACTGCTGAAGG + Intergenic
958933211 3:100229629-100229651 CAGTGTCTTCTTTCAATAGAAGG - Intergenic
959442293 3:106392265-106392287 CAGTGTCATATTTCTCTTGAGGG - Intergenic
959765865 3:110027265-110027287 CAGTGTAATCTTGCAGTGGCAGG - Intergenic
960574496 3:119216860-119216882 CATTGCCATTTTACAGATGAGGG - Intronic
964599779 3:158486262-158486284 CATTGACCTCTTACAGTTAATGG + Intronic
964892919 3:161558040-161558062 CTGTATCACCTTACAGATGATGG + Intergenic
965172387 3:165282889-165282911 CAGTGACTGCTTTCAGTTGAGGG + Intergenic
965988069 3:174780857-174780879 CAGTTTCTTCGTACTGTTGATGG + Intronic
966938954 3:184733227-184733249 CAGTCTCATCTTACAGAGGAGGG + Intergenic
970205577 4:13652553-13652575 CTCTCTCATTTTACAGTTGAAGG + Intergenic
970446226 4:16125318-16125340 CATCGTCATTTTACAGGTGAGGG - Intergenic
972124684 4:35748521-35748543 TAGTGTCTCCTTTCAGTTGAAGG + Intergenic
974321168 4:60352381-60352403 CATTAACATCTTACATTTGATGG - Intergenic
975539580 4:75492981-75493003 CAGTGGCATCTCTGAGTTGATGG + Intronic
976472949 4:85450775-85450797 CAATCTCATTTTACAGATGAAGG + Intergenic
977500460 4:97830437-97830459 CAGTTTCTTCATAGAGTTGATGG - Intronic
980503360 4:133684294-133684316 CTGTGTGATCTTACACTGGAGGG - Intergenic
981492130 4:145350624-145350646 CCGTGTCATTTTATAGATGAGGG + Intergenic
981845798 4:149167285-149167307 GAATGTCATCTTATAGATGAAGG + Intergenic
981904151 4:149901427-149901449 CAGTTTCATCTTACAGATTACGG + Intergenic
982186384 4:152805772-152805794 CATTATCATCTTACAGATGAAGG + Intronic
982849817 4:160298383-160298405 TAGAGTAATTTTACAGTTGATGG - Intergenic
982936101 4:161477361-161477383 CATTGTCATCTTAAATCTGAGGG + Intronic
985748913 5:1663465-1663487 GAGTGTCTCCTTACGGTTGAGGG + Intergenic
986879799 5:12155562-12155584 CAGTTTCTTCATACTGTTGATGG - Intergenic
987166483 5:15203452-15203474 CAATGACATCTGAAAGTTGAAGG - Intergenic
990485087 5:56250328-56250350 TATTCTCATCTTACAGATGAGGG - Intergenic
990625696 5:57607999-57608021 CTGTGTCATCACACAGTAGAAGG - Intergenic
995674866 5:114652046-114652068 CAGTATCAGGTTACAGTTAAGGG + Intergenic
998607837 5:143653648-143653670 CACTTTCATCTTACGGGTGAGGG + Intergenic
1005050477 6:21679303-21679325 CAGTGTCAGAACACAGTTGAAGG + Intergenic
1006153778 6:32003192-32003214 CAGTGTCTTCTTCCAGTTACTGG + Intergenic
1006160086 6:32035929-32035951 CAGTGTCTTCTTCCAGTTACTGG + Intergenic
1007280631 6:40709781-40709803 CTGTGTCATCCTATAGTGGAAGG + Intergenic
1010063177 6:71648075-71648097 CAGTGTCATTGTTCATTTGAAGG + Intergenic
1011181179 6:84622599-84622621 CATTTGCATCTTACAGTTAAAGG - Intergenic
1012070604 6:94609679-94609701 TGGTGTCAACTGACAGTTGATGG + Intergenic
1014942727 6:127462516-127462538 CCTTCTCATTTTACAGTTGAGGG + Intronic
1015041446 6:128725170-128725192 CAGGGAAATCTTACATTTGAAGG - Intergenic
1015848661 6:137549205-137549227 TATTTTCATCTTACAGGTGATGG + Intergenic
1016676356 6:146773921-146773943 CATTGTCATTTTACAGATGAGGG + Intronic
1016798526 6:148144015-148144037 CCGTGGCATCTTTCAGCTGAAGG + Intergenic
1017694672 6:157002887-157002909 CAGTGACATCTTAGACTTGAAGG + Intronic
1018337286 6:162806876-162806898 CAGTGTCCTCTTCCAATAGAAGG + Intronic
1021701017 7:23319480-23319502 CAGTGACATTTTAAAGTTTAAGG - Intronic
1023630720 7:42161603-42161625 CAATATCATCCTACAGATGACGG + Intronic
1027727660 7:81828119-81828141 CAGTTTCTTCTTACCATTGATGG + Intergenic
1030788190 7:113688538-113688560 CAGTGTCATAATGAAGTTGAAGG - Intergenic
1031625156 7:123984188-123984210 ATGGTTCATCTTACAGTTGATGG - Intergenic
1032007804 7:128317862-128317884 TAGTGTCCTCTGACATTTGAGGG - Intronic
1033881774 7:145893068-145893090 CATTATCATCTTACAGATGAGGG + Intergenic
1034844041 7:154427474-154427496 CAGCCTCTTCTGACAGTTGAAGG - Intronic
1038249835 8:25893039-25893061 CAAGGTCATGTTACAGTCGAAGG + Intronic
1040067598 8:43160606-43160628 CACTGTGATTTTACAGTTTAGGG - Intronic
1040872567 8:52115991-52116013 CAATGTCATGTGAAAGTTGAAGG - Intronic
1043089002 8:75874456-75874478 CAGTTTCTTCTTAGAATTGATGG + Intergenic
1045678062 8:104630005-104630027 CAGTGTAATCTTACAGTTTATGG + Intronic
1045946932 8:107806828-107806850 TAGTTTCATTTTACAGATGAGGG - Intergenic
1047603340 8:126449658-126449680 CTGAGTCATCTTAGGGTTGAGGG + Intergenic
1049266289 8:141669566-141669588 CTGTGTCCTCACACAGTTGAAGG - Intergenic
1050136701 9:2473129-2473151 CAGTGTCAGATAACAGGTGATGG - Intergenic
1053556356 9:39142037-39142059 CAGTCTCATCTAATAGTTGACGG - Intronic
1053820470 9:41962320-41962342 CAGTCTCATCTAATAATTGACGG - Intronic
1054089333 9:60830448-60830470 CAGTCTCATCTAATAATTGATGG - Intergenic
1054110744 9:61106006-61106028 CAGTCTCATCTAATAATTGATGG - Intergenic
1054610113 9:67225119-67225141 CAGTCTCATCTAATAATTGATGG + Intergenic
1055043749 9:71903501-71903523 ATGTATCATCTTGCAGTTGAAGG - Intronic
1055801163 9:80038127-80038149 AAGGGTCATCTTTCATTTGATGG - Intergenic
1057371214 9:94475242-94475264 CTGTGTGTTCTTACAGTTTAAGG - Intergenic
1062043410 9:134414470-134414492 CATTTTCATCTTACGGATGAGGG + Intronic
1185850235 X:3478710-3478732 CTGCGTCATTTTACTGTTGAGGG - Intergenic
1190850029 X:54231084-54231106 CAGTGTTATCTAACAGTTTTGGG + Intronic
1191657652 X:63615524-63615546 CAGTTTCTTCATACTGTTGATGG - Intergenic
1193949540 X:87780478-87780500 CAGTTTCTTCATAGAGTTGATGG - Intergenic
1195168715 X:102245571-102245593 CAGTGTCATCTTTCAGTAGATGG - Intergenic
1195190142 X:102441516-102441538 CAGTGTCATCTTTCAGTAGATGG + Intronic
1197847252 X:130815810-130815832 CAGTGTCTTCATAGTGTTGATGG - Intronic
1198367337 X:135954705-135954727 TACTCTCATCTTACATTTGATGG + Intergenic
1200939261 Y:8765253-8765275 CATGGTCTTCTTATAGTTGAGGG - Intergenic
1201752064 Y:17443867-17443889 CAGTTTCGTCATACAGTTGATGG + Intergenic