ID: 1132912380

View in Genome Browser
Species Human (GRCh38)
Location 16:2321135-2321157
Sequence GAGCTGAGCAGCTCCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132912377_1132912380 -8 Left 1132912377 16:2321120-2321142 CCCAAAAACAGGAGGGAGCTGAG 0: 1
1: 0
2: 3
3: 40
4: 345
Right 1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG 0: 1
1: 0
2: 2
3: 38
4: 331
1132912372_1132912380 12 Left 1132912372 16:2321100-2321122 CCAAGCTTAGGGAATTGTTCCCC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG 0: 1
1: 0
2: 2
3: 38
4: 331
1132912376_1132912380 -7 Left 1132912376 16:2321119-2321141 CCCCAAAAACAGGAGGGAGCTGA 0: 1
1: 0
2: 2
3: 22
4: 217
Right 1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG 0: 1
1: 0
2: 2
3: 38
4: 331
1132912378_1132912380 -9 Left 1132912378 16:2321121-2321143 CCAAAAACAGGAGGGAGCTGAGC 0: 1
1: 0
2: 1
3: 33
4: 245
Right 1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG 0: 1
1: 0
2: 2
3: 38
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132912380 Original CRISPR GAGCTGAGCAGCTCCTGCCT GGG Intronic
900387896 1:2418974-2418996 GAGGTGAGCAGGTCCTCTCTCGG - Intergenic
900418864 1:2547021-2547043 GGGCTGAGCAGCCCCTCCCATGG + Intergenic
900798851 1:4725568-4725590 GAGGTCACCAGCTCCTTCCTTGG + Intronic
900831973 1:4971921-4971943 GAACTGAGCCTCTCCTGCTTAGG + Intergenic
901002166 1:6154311-6154333 GAGTGGAGCCGCTCCAGCCTGGG - Intronic
901039909 1:6357623-6357645 GAGCTCAGCAGAGGCTGCCTTGG + Intronic
901261324 1:7874129-7874151 GATCTGAGCTGATCCTGGCTGGG - Intergenic
901647913 1:10726620-10726642 GCGCTGTGCGGCCCCTGCCTGGG + Intronic
901685011 1:10938944-10938966 GAGCAGAGCAAGTCCTGCGTGGG - Intergenic
901777071 1:11567393-11567415 GAGCTCAGTACCTCCTGCATAGG - Intergenic
902050772 1:13562183-13562205 GAGCTGAGCAGCAGCAGTCTGGG - Intergenic
902448943 1:16484690-16484712 GTGCTGAGCAGCTACAGCCTGGG + Intergenic
902468324 1:16631397-16631419 GTGCTGAGCAGCTACAGCCTGGG + Intergenic
902505814 1:16938594-16938616 GTGCTGAGCAGCTACAGCCTGGG - Intronic
903154802 1:21436261-21436283 GTGCTGAGCAGCTACAGCCTGGG - Intergenic
903384356 1:22916834-22916856 GAGCTGTGCAGCGCCAGGCTGGG + Intergenic
903448497 1:23437264-23437286 GCCCTGAGCAGCGCCTTCCTCGG - Exonic
904000301 1:27335159-27335181 GCGCGGAGCAGCCCCTGCCCGGG + Intronic
904214817 1:28910960-28910982 GAGCAGAGCTGTTTCTGCCTTGG + Intronic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
905339111 1:37266211-37266233 GAGCTGAGCTCAACCTGCCTTGG - Intergenic
905693802 1:39960657-39960679 CAGCTGAGCAGCTGCTGCTGAGG - Intronic
905717308 1:40162704-40162726 GAGATGAGGTGCTTCTGCCTCGG - Intronic
905942197 1:41873121-41873143 GTCCTGAGCAGACCCTGCCTGGG - Intronic
906129041 1:43445050-43445072 AAGCTGGGCAGCTCCTCCCCAGG - Intronic
906977317 1:50589367-50589389 CACCTGAGCTGCTCCTGCTTGGG - Intronic
907407012 1:54259791-54259813 GAAGTGAGCAGCTCCTCGCTTGG - Intronic
907809660 1:57856070-57856092 GGTCTGAGCTGCTACTGCCTGGG + Intronic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
912931074 1:113962386-113962408 TGGCTGAGCAGCTGGTGCCTGGG - Exonic
913578088 1:120197258-120197280 GAGCTGAGCAGCAGCGGCCGAGG + Intergenic
914334049 1:146699178-146699200 GAGCCGAGCAGCCTCTGGCTTGG + Intergenic
915430063 1:155859669-155859691 GAGCTCTACAGCTGCTGCCTCGG + Exonic
915552097 1:156641294-156641316 GCGCTGAGGAGTTCCTGGCTGGG + Intergenic
918405558 1:184208560-184208582 GTGCTCAGGAGCTTCTGCCTCGG - Intergenic
920350185 1:205332803-205332825 GAGCTGCAAAGCTCCTGCATGGG - Intergenic
920776756 1:208945831-208945853 GAGCTGGGCAGCTTCTGCAAAGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922857846 1:228790367-228790389 GAGCTGAGCAGCTCCAGCTGGGG + Intergenic
923648227 1:235845836-235845858 GAGCTCAGCAGCTCCTTGGTTGG - Intronic
1062844462 10:693132-693154 GAGAGGAGCAGCCCCTTCCTCGG + Intergenic
1063620853 10:7647349-7647371 GAGCCCAGCTGCTCCTGCCAAGG + Intronic
1067286479 10:44911225-44911247 GGGCTGAGCGGCTCCAGCCCAGG + Exonic
1067781114 10:49208246-49208268 GACATGAGCAGCTCGTGCCGGGG + Intergenic
1068629548 10:59285181-59285203 GAGCTCAGCGGCTGCTGTCTGGG + Intronic
1069689489 10:70340535-70340557 GAGCTGACCAGGGCCTACCTCGG + Exonic
1071471078 10:85984409-85984431 GACATAAGCAGCTCATGCCTTGG - Intronic
1071511402 10:86264682-86264704 GGGCAGAGCGGCTCCTGCATGGG - Intronic
1071541216 10:86485950-86485972 AAGCTGAGCAGGTTCTGGCTGGG - Intronic
1073443281 10:103565229-103565251 GTGCTGGGCATCTCCTGCCATGG - Intronic
1074288514 10:112120739-112120761 GAGCTGAGCAGGTCCTGGGTGGG - Intergenic
1075071600 10:119323599-119323621 GAGCTGGGCAGCAGCTGCCCGGG - Intronic
1075506550 10:123027921-123027943 GATCTGACCAGATCCTGCCAGGG + Intronic
1075991181 10:126840150-126840172 GCCCTGAGCAGTTCCTGGCTGGG - Intergenic
1076128047 10:127991852-127991874 GAGCTATGTAGCTCCTGTCTTGG + Intronic
1076343517 10:129765667-129765689 GAGATGGTCAGCCCCTGCCTTGG - Intronic
1077304653 11:1863719-1863741 GGGCTGGGCTGCTCCTCCCTGGG + Intronic
1078142852 11:8704160-8704182 GAGCTGAGTAGTTACAGCCTGGG + Intronic
1082787268 11:57324121-57324143 GGGCTGGGCAGCTCCAGCCCCGG + Intronic
1082884040 11:58065692-58065714 GAGCCCAGCAACTTCTGCCTGGG - Intronic
1083428619 11:62602268-62602290 GAGCCGGGCAGCCCCAGCCTAGG - Exonic
1084267198 11:68011048-68011070 AAGCTCAGCAGCCCCTCCCTTGG - Intronic
1084272946 11:68038782-68038804 GAGCGGAGCTGCCCCTGCATCGG + Intergenic
1084369684 11:68732466-68732488 GAGCTGCTCAGCTGCTGGCTGGG - Intronic
1084436978 11:69148674-69148696 GAGCTCAGCAGCCCCTGCATTGG - Intergenic
1085405154 11:76257285-76257307 GAGCCGTTCAGCACCTGCCTGGG + Intergenic
1085409488 11:76282817-76282839 GAGCTGACCAGCTGCTCCCTGGG - Intergenic
1085704077 11:78770436-78770458 AAGATGAGCACCTCCTTCCTTGG + Intronic
1086021071 11:82230194-82230216 GATGTGAGCAGCTGCTCCCTTGG - Intergenic
1086425468 11:86678376-86678398 TAGCTCAGCAGCTGCTGCCATGG - Intergenic
1086595665 11:88567699-88567721 GGGCTGAGTAGCTCATGGCTGGG + Exonic
1086889578 11:92241232-92241254 GAGCTTAACAGCTCCTTCTTGGG + Intergenic
1088655911 11:111999804-111999826 GCGGTGAGCTGCTCCAGCCTGGG + Intronic
1090657492 11:128857107-128857129 GTGCGGCGCAGCTCCTGCCCTGG + Intronic
1091318465 11:134632657-134632679 GAGCTCAGCAGCCCAGGCCTGGG - Intergenic
1091406823 12:214368-214390 GGGCTGAGCTGCTGCTCCCTTGG + Intronic
1094256357 12:28432326-28432348 GACCTGATCACCTCCTGTCTAGG + Intronic
1096864013 12:54550529-54550551 GAGATGAGCAGCTCAGGCATGGG - Intronic
1100618435 12:96249569-96249591 GATCTGAGCATCTCCTCCCCTGG + Intronic
1101407281 12:104439682-104439704 GATCTGAGAAGCACCTGCCAGGG - Intergenic
1102217685 12:111173167-111173189 GAGCTGGGCATCTACTGCGTGGG + Intronic
1102932383 12:116872542-116872564 GAGCTCAAGACCTCCTGCCTTGG - Intronic
1103343053 12:120231316-120231338 TAGCAGAGCAGTTCCTGTCTGGG - Intronic
1103636983 12:122315059-122315081 GATCTGAGCTGCTCCTGCGAGGG - Intronic
1104040833 12:125129483-125129505 GAGCTGGCCAGCCTCTGCCTTGG + Intronic
1105775668 13:23657956-23657978 GTGGTGAGCAGCACCTGCCGGGG + Intronic
1106140325 13:27006229-27006251 CAGCTGAGCTGCTCCTTCCCTGG + Intergenic
1106181603 13:27374152-27374174 AAGATGATGAGCTCCTGCCTGGG + Intergenic
1107069929 13:36258234-36258256 CAGCTCAGCAGCTGCTGTCTGGG + Intronic
1108523519 13:51265385-51265407 GAGCTGAGCAGCTGCAGGCCTGG + Intronic
1109175373 13:59148900-59148922 GAGCTCAGCTTATCCTGCCTGGG - Intergenic
1111297271 13:86296655-86296677 GAGCTAGGCAGCTGCTGCATTGG - Intergenic
1113708232 13:112447563-112447585 TAGCTGGGCACCTCCTGCCCAGG - Intergenic
1114618327 14:24080359-24080381 GGGCTGTGCATCCCCTGCCTAGG + Exonic
1117985391 14:61381647-61381669 TTGCTTAGCAGCTCCCGCCTCGG + Intronic
1118303710 14:64636980-64637002 CAGCTGAGTAACTCCTTCCTGGG - Intergenic
1118636344 14:67751817-67751839 GAGCTGAGATACTCCAGCCTGGG + Intronic
1120955670 14:90079813-90079835 GAGCTCTGCAGGCCCTGCCTGGG + Intronic
1121102420 14:91259108-91259130 GAGCTGAATAGCCCCAGCCTGGG - Intergenic
1121962982 14:98278266-98278288 GAGCTGAGCATTATCTGCCTGGG - Intergenic
1121991409 14:98561380-98561402 GTGCTGAGCAGCTCATCCCATGG - Intergenic
1122232716 14:100314860-100314882 GTGCTGTGCTGCTCCAGCCTGGG + Intergenic
1122459678 14:101884650-101884672 GAGCTGAGCAGAGGCTGGCTGGG - Intronic
1122672728 14:103384885-103384907 GATCTGAGCAGCTGCGGGCTGGG - Intergenic
1123032541 14:105458702-105458724 GAGCAGAGCAGCTGCAGCCCGGG + Intronic
1123197059 14:106627164-106627186 GCGCTGAGCAGCACCTGCGCCGG + Intergenic
1123510225 15:20991435-20991457 GAGGTGAGCAGTCCCTGCGTTGG + Intergenic
1123567441 15:21565188-21565210 GAGGTGAGCAGTCCCTGCGTTGG + Intergenic
1123603705 15:22002481-22002503 GAGGTGAGCAGTCCCTGCGTTGG + Intergenic
1124686319 15:31785815-31785837 GAGGAGAGCAGCACCTTCCTTGG + Intronic
1125214474 15:37254665-37254687 GAGGTGTGCACCACCTGCCTGGG + Intergenic
1126344424 15:47677382-47677404 GATCTTAGCAGCTTCTCCCTGGG - Intronic
1127333024 15:57956988-57957010 GAGCAGAGCTGCTCCTCTCTGGG + Intronic
1127659254 15:61084700-61084722 GAGCGGAGCAGCTGCTTCCCCGG - Intronic
1127976157 15:63998638-63998660 AACCTCAGCTGCTCCTGCCTGGG - Intronic
1128174770 15:65545495-65545517 GAGCTGAGACACTCCAGCCTGGG - Intronic
1128833855 15:70793698-70793720 CAGCAGAGCACCTTCTGCCTGGG - Intergenic
1129230052 15:74192103-74192125 GAGCTGACCCACTCCTGCCCGGG - Intronic
1129777769 15:78247976-78247998 GAGAGGTGCAGCCCCTGCCTTGG + Intergenic
1130373308 15:83305769-83305791 GAGCTGAACATCTCCTGACCAGG + Intergenic
1130540550 15:84818023-84818045 GAGCTAAGCAGCTCCTACTCTGG - Intronic
1131837547 15:96406311-96406333 GTGTTTAGGAGCTCCTGCCTGGG + Intergenic
1132031839 15:98444878-98444900 GAGCTGAGAAGCGCCTGCCATGG + Intronic
1132289119 15:100686914-100686936 GAACTGAGGAGCTTCTGCCAAGG - Intergenic
1202975805 15_KI270727v1_random:292282-292304 GAGGTGAGCAGTCCCTGCGTTGG + Intergenic
1132464763 16:72404-72426 GCTCTGAGCAGCTCCGGCCCCGG + Intronic
1132629476 16:910266-910288 CAGATGAGCAGCCCCTGGCTGGG + Intronic
1132699122 16:1214835-1214857 CAGCTCAGTAGCTCCTCCCTGGG - Intronic
1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG + Intronic
1132921296 16:2395880-2395902 GAGCTGGGCATCTCCAGCTTTGG + Intergenic
1133247087 16:4456060-4456082 GAGCAGAGCAGCTGATGCCTCGG - Exonic
1133301959 16:4787923-4787945 GACCTGAGAGGCCCCTGCCTGGG - Intronic
1133509009 16:6439988-6440010 GAGCTGAGGCACTCCAGCCTGGG - Intronic
1134257361 16:12623243-12623265 TAGCTGAGGAACTCCAGCCTCGG - Intergenic
1134845995 16:17441106-17441128 GAGCTGAGGCACTCCAGCCTGGG - Intronic
1136066920 16:27765548-27765570 GAGCTCTGCAGCTCTTGGCTTGG - Intronic
1137770761 16:51014180-51014202 AAGCTGAGGAGACCCTGCCTAGG - Intergenic
1137770823 16:51014414-51014436 AAGCTGAGGAGACCCTGCCTAGG - Intergenic
1137770853 16:51014531-51014553 AAGCTGAGGAGACCCTGCCTAGG - Intergenic
1137770883 16:51014648-51014670 AAGCTGAGGAGACCCTGCCTAGG - Intergenic
1137770923 16:51014805-51014827 AAGCTGAGGAGACCCTGCCTAGG - Intergenic
1137770973 16:51015002-51015024 AAGCTGAGGAGACCCTGCCTAGG - Intergenic
1137771012 16:51015159-51015181 AAGCTGAGGAGACCCTGCCTAGG - Intergenic
1138086499 16:54138654-54138676 CAGCTGAGCAGCTGCTTCCAAGG + Intergenic
1138194770 16:55044030-55044052 GATCTGATCAGCTACTGGCTGGG - Intergenic
1138204224 16:55113285-55113307 TTGCTGAGCAACTCCTGCCCAGG + Intergenic
1138347107 16:56326773-56326795 GAGCAGAGCAGGTGCTGCCCCGG - Intronic
1138556918 16:57776186-57776208 CAGCTCAGCAGCTTCAGCCTGGG - Intronic
1139740465 16:69031110-69031132 GAGATGAGGAGCTGCTGCTTTGG + Intronic
1139949465 16:70662110-70662132 GAGCTGGGCAGCTCCTGGGTAGG - Exonic
1139966956 16:70751063-70751085 GCTCTGAGCAGCTCCTGCCAAGG + Intronic
1139999569 16:71012071-71012093 GAGCCGAGCAGCCTCTGGCTTGG - Intronic
1140352934 16:74279932-74279954 GAGCTGAGCTGCTCCTGTGTGGG + Intergenic
1140883551 16:79221312-79221334 AGGCTGAGCAGATCCTCCCTGGG + Intergenic
1141079621 16:81038545-81038567 CCCCTGAGCAGCTCCTGTCTTGG + Intronic
1142185812 16:88694255-88694277 GAGCTCAGCAGATCCTGCCATGG - Intergenic
1142210226 16:88805090-88805112 GCGGGGGGCAGCTCCTGCCTCGG + Intronic
1142223882 16:88868028-88868050 CAGCAGTGCAGCTCCAGCCTAGG - Intergenic
1142230157 16:88896353-88896375 GATCTTAGCAGCGCCTTCCTGGG + Intronic
1142302261 16:89265595-89265617 GCGCTACCCAGCTCCTGCCTGGG - Intergenic
1142397054 16:89838051-89838073 GAGCTGAGGCACTCCAGCCTGGG - Intronic
1142551719 17:744861-744883 AAGATGAGCAGCTTCTGACTTGG - Exonic
1144793091 17:17872671-17872693 GAGCTCAGCAGTGCCTGGCTCGG - Intronic
1145995696 17:29103609-29103631 GAGAAGAGCAGCTGCTGCATGGG - Exonic
1147667727 17:42159437-42159459 GAGGTGAGCCTCTCCAGCCTGGG + Intronic
1148156201 17:45426469-45426491 GAACAGAGGAGCTCCTGCCATGG - Intronic
1150439499 17:65179735-65179757 GAGCTGAGCTGCTCCATCCTGGG + Intronic
1150885987 17:69086291-69086313 GAGCTGAGCAGCGCCAGATTAGG - Intronic
1151456543 17:74229524-74229546 GAGCTGAGGAACTCTTTCCTGGG - Intronic
1152112211 17:78363235-78363257 GAGCTGAGCTGCTGCAGCTTGGG + Intergenic
1152132984 17:78488429-78488451 GAGGTGTCCAGTTCCTGCCTTGG + Intronic
1152361191 17:79833890-79833912 GAGCTGAGCACCTGGGGCCTCGG - Exonic
1152779801 17:82221823-82221845 GAGCCCAGGAGTTCCTGCCTGGG + Intergenic
1157306616 18:46522029-46522051 GAGCTGACCAGTTCCTGGGTGGG - Intronic
1157932907 18:51842741-51842763 GAGCTGAGCTGGGCCAGCCTGGG + Intergenic
1157965402 18:52203159-52203181 GAGATAAGCCGCTCCTGCTTGGG - Intergenic
1158604283 18:58881364-58881386 GACCTCAGCTGATCCTGCCTCGG + Intronic
1159284985 18:66337128-66337150 GAGCTGTGTTGCTGCTGCCTGGG + Intergenic
1160223828 18:76997315-76997337 GAGCTGGGAAGCTCCAGCCCGGG + Intronic
1160854024 19:1207918-1207940 GCGCGGAGAAGCTCCTACCTAGG + Intronic
1161010765 19:1958490-1958512 GAGCTGAGCTGCTGCGGCCCTGG - Intronic
1161010783 19:1958549-1958571 GAGCTGAGCTGCTGCAGCCCTGG - Intronic
1161010807 19:1958616-1958638 GAGCTGAGCTGCTGCGGCCCTGG - Intronic
1161010825 19:1958675-1958697 GAGCTGAGCTGCTGCAGCCCTGG - Intronic
1161010842 19:1958734-1958756 GAGCTGAGCTGCTGCGGCCCTGG - Intronic
1161700021 19:5789405-5789427 GAGCTGAGCAGGCCCTGCGCCGG - Exonic
1162020138 19:7864558-7864580 TCGCTGGGAAGCTCCTGCCTGGG - Intronic
1162531783 19:11240243-11240265 CAGCTGAGGAGCGCCTGGCTGGG + Exonic
1162787462 19:13044692-13044714 CAGCTGAGCAGTTCCTTTCTGGG + Intronic
1163007180 19:14404398-14404420 GCACAGAGCAGCTCCTGCCGTGG - Exonic
1163154561 19:15432734-15432756 GCGCTCAGCTGCTCCCGCCTGGG - Intronic
1163517949 19:17776097-17776119 GAGCTGTGCCGCTGCTGCCTCGG - Exonic
1164180863 19:22817344-22817366 GAGATAAGAAGCTCCTGCCTAGG + Intergenic
1164256192 19:23530315-23530337 GGGATGAGAGGCTCCTGCCTGGG - Intronic
1164294841 19:23900834-23900856 GGGATGAGAGGCTCCTGCCTGGG + Intergenic
1164752229 19:30665511-30665533 GGGCTGAGGAGGGCCTGCCTGGG + Intronic
1165791651 19:38496337-38496359 GAGCTCCCCAGCACCTGCCTGGG - Intronic
1166334194 19:42095633-42095655 CAGCTGAGCAGCCCCAGCCTGGG - Exonic
1166650085 19:44566752-44566774 GAGCAGAGCATCTCCTGGCTAGG + Intergenic
1166652648 19:44586184-44586206 TAGCTGAGGAGCCCCTGGCTGGG + Intergenic
1167079756 19:47270984-47271006 GCTCTGGGCAGCTCCTCCCTAGG + Intronic
1168406067 19:56111327-56111349 GTGCTCAGCAGCTGCTGCCCTGG + Intronic
925234456 2:2265906-2265928 GAGCTGTGAAGGTGCTGCCTGGG + Intronic
925283378 2:2700528-2700550 GACCTGAGCCCCTCCTGGCTGGG + Intergenic
925569885 2:5297900-5297922 GAGCTGCGCAGCATTTGCCTGGG + Intergenic
925730483 2:6917089-6917111 GAGCTGTGCAGCTGCGCCCTGGG - Intergenic
925879102 2:8336020-8336042 GAGCTGAGCAGTTCCAGCATAGG + Intergenic
926039083 2:9658491-9658513 GAGCTGTGATGCTCCAGCCTAGG - Intergenic
926220215 2:10931294-10931316 GAGCTGAGCAGCTGCCACCTGGG + Intergenic
927700959 2:25268644-25268666 GAGCTGAGGAGAACCTTCCTTGG - Intronic
929594896 2:43169832-43169854 GAACAGAGCAGGTCCTCCCTGGG - Intergenic
929930540 2:46252376-46252398 GAGCTCACCAGCTTCTGGCTGGG - Intergenic
934028303 2:88018776-88018798 GGGCAGGGCACCTCCTGCCTGGG - Intergenic
934818184 2:97348455-97348477 GCACTGAGCAGCCCCTGCCCAGG - Intergenic
936111702 2:109670575-109670597 GAGGAGAACAGCCCCTGCCTTGG - Intergenic
938421982 2:131153541-131153563 GAACTGGGCAGGGCCTGCCTGGG - Intronic
942021518 2:171870991-171871013 GAGCTCAGGAGTTCCAGCCTGGG + Intronic
947918516 2:233850113-233850135 GAGCTTATCTGCTCGTGCCTGGG - Intronic
947969416 2:234309867-234309889 GACCTGAACAGCTCTTGCCTCGG + Intergenic
948783560 2:240339589-240339611 TAGCTGAGCAGCTCCTGAGGGGG + Intergenic
1169223050 20:3837895-3837917 GAGCTGAAGAGTTCCAGCCTGGG - Intergenic
1170255249 20:14335257-14335279 ATGCTCAGCATCTCCTGCCTAGG - Intronic
1171370762 20:24660840-24660862 GAGATGACCAGCCCCTGGCTGGG - Intronic
1171382084 20:24741861-24741883 GAACCGCACAGCTCCTGCCTGGG - Intergenic
1171459991 20:25292826-25292848 GTGCTGGGCTGCTCCTGTCTCGG + Intronic
1173228478 20:41175934-41175956 GAGCAGAGTACATCCTGCCTGGG + Intronic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1175373537 20:58509184-58509206 TACCTGGGCAGCTCCTGGCTTGG - Intronic
1175485349 20:59342198-59342220 GAGCTTGGCTACTCCTGCCTTGG + Intergenic
1176284370 21:5011701-5011723 GAGCTGAGCAGGGTCTGCCCTGG + Intergenic
1177157537 21:17513749-17513771 CTGGTTAGCAGCTCCTGCCTGGG - Intronic
1178702307 21:34844151-34844173 GATCAGAGTAGCTCCTGCCCAGG + Intronic
1178881561 21:36454122-36454144 GAGCCCACCAGCTCCTGCCGGGG - Intergenic
1179440466 21:41390111-41390133 TCGCTGAGCACCTGCTGCCTGGG + Intronic
1179872811 21:44251774-44251796 GAGCTGAGCAGGGTCTGCCCTGG - Intronic
1179935797 21:44602663-44602685 CACGTGAGCAGCTTCTGCCTGGG - Intronic
1179961249 21:44768036-44768058 CACGTGAGCAGCTTCTGCCTGGG - Intergenic
1180214868 21:46317617-46317639 GAGCTGAGCAGCTACCTGCTGGG + Intronic
1180833522 22:18918582-18918604 GGGCTGGGCAGCAGCTGCCTGGG + Intronic
1180995360 22:19962823-19962845 GAGCTGAGCACCTGCTGGCCCGG - Intronic
1181066305 22:20307673-20307695 GGGCTGGGCAGCAGCTGCCTGGG - Intergenic
1181068687 22:20319547-20319569 GTGCAGATCAGCTCCTTCCTTGG - Intronic
1181581487 22:23831355-23831377 GACGTGAGCATCCCCTGCCTGGG + Intronic
1182081777 22:27534396-27534418 GAGCTGCTCTGCTCCAGCCTAGG - Intergenic
1183271206 22:36863604-36863626 GAACTGAGCAGCTCCATCCAGGG + Intronic
1184240495 22:43209137-43209159 ATGCTGAGCAACTCCTGCCCAGG + Intronic
1184284520 22:43461994-43462016 CAGCTGAGCAGCTCCTCACCTGG - Intronic
1184448386 22:44567817-44567839 CATCTCAGCAGCTCCAGCCTTGG - Intergenic
1184695607 22:46137268-46137290 GAGTTGAGCAGCTCCTGGCTGGG + Intergenic
1203283607 22_KI270734v1_random:143880-143902 GGGCTGGGCAGCAGCTGCCTGGG + Intergenic
950031777 3:9858533-9858555 GAGCTGACCTGCTCCTTCCTTGG - Intergenic
950094479 3:10320941-10320963 GAGCTGAACGGCTCCAGCTTGGG + Intronic
950259633 3:11534825-11534847 GAGCTGAGCTACTCCTCCCTAGG - Intronic
950521761 3:13501697-13501719 GAGCTGTGCAGCTCCAGCTGTGG - Intronic
951628011 3:24687916-24687938 GAGGAGAGCAGCTCTTGCTTGGG - Intergenic
953960612 3:47263250-47263272 CAGCTGAGCACCTCCAGCTTGGG - Intronic
954295954 3:49674549-49674571 GCGCTGAGCGCCGCCTGCCTGGG + Exonic
954645761 3:52130685-52130707 GAGCTCTGTAGCTCCTGTCTAGG - Intronic
954685051 3:52365731-52365753 GGGCTGAGCAGGAACTGCCTAGG - Intronic
956485307 3:69716329-69716351 GATCTTAGCAGCTCCTGGCAGGG + Intergenic
956748242 3:72326601-72326623 CAGCTGAGCAGCACCTGGCTGGG + Intergenic
961783823 3:129337532-129337554 GAGCTGACCTGCTCCTTCCTTGG - Intergenic
961831167 3:129623668-129623690 GACCTCAGCAGCTCCTGGTTGGG + Intergenic
967967343 3:194972382-194972404 GAGCTGGACAGTTCCTGCTTGGG - Intergenic
968052697 3:195666390-195666412 GAGGACAGCAGCACCTGCCTCGG + Intergenic
968301426 3:197619542-197619564 GAGGACAGCAGCACCTGCCTCGG - Intergenic
968487642 4:871605-871627 GAGGTCAGCAGGGCCTGCCTTGG + Intronic
968516438 4:1017542-1017564 GACCTGGGCAGGTGCTGCCTCGG + Intronic
968895885 4:3403069-3403091 GAGCAGAGCGGCTCCTGCGAAGG - Intronic
968973023 4:3805953-3805975 ACGCTGAGCAGCCTCTGCCTGGG + Intergenic
970482635 4:16493051-16493073 GAACTCAGCAGCGCCTGCCATGG - Intergenic
970683363 4:18536497-18536519 ATCCTGAGCAGCCCCTGCCTGGG + Intergenic
972679053 4:41288135-41288157 GCGGTGACCAGCTTCTGCCTTGG + Intergenic
973677939 4:53285716-53285738 GTTCTGAGCAGATCCTGACTAGG - Intronic
975247349 4:72134817-72134839 GGGCAGAGCAGCTCCTGCTCTGG + Intronic
981752794 4:148108743-148108765 GAGCTGAGCAGGCCTTGGCTTGG - Intronic
982069083 4:151679481-151679503 GAGCTGAGCTGAGGCTGCCTTGG + Intronic
985677411 5:1239144-1239166 GGTTTGAGCAGCTCCTGCATGGG - Intronic
985891642 5:2720266-2720288 GAGCTGACCAGCTCCTGGCGTGG - Intergenic
986559286 5:9044533-9044555 GGGCTGAGCAGCTCCATCCTCGG - Exonic
987127798 5:14831097-14831119 CTGCTGAACAGCTCCTGGCTGGG + Intronic
987403995 5:17506733-17506755 GAGCTCAGGAGTTCCTGTCTAGG - Intergenic
988831015 5:34987368-34987390 GAACTGAGTTGCTCCTGGCTGGG + Intergenic
989606039 5:43245558-43245580 GAGGCGAGCAGCTCCTGGCTGGG + Exonic
993991243 5:94660837-94660859 GATCTGAGGAGCTCCTGCTTTGG + Intronic
997625724 5:135329445-135329467 GAGCTGAGAGGGTCATGCCTGGG + Intronic
998216079 5:140239562-140239584 GAGCTGAGCAGTTTCTGGCAGGG - Intronic
999315955 5:150584114-150584136 GGGCTGAGCTGCTCTTGCCCTGG - Intergenic
999906741 5:156149539-156149561 GAGGTGAGCAGCCCATCCCTAGG - Intronic
1001053419 5:168430504-168430526 GTGGTGAGCAGATCCTTCCTGGG + Intronic
1002101172 5:176858394-176858416 GAGGTGGGAAGCTCCTGCCTCGG + Intronic
1002640654 5:180629124-180629146 GAGCTGCCCAGCTCCTGCACCGG - Intronic
1002694290 5:181073815-181073837 GAGCTGAGCAGCACTTGCGGAGG + Intergenic
1003213698 6:4090099-4090121 GAGGGAAGCAGCTCCAGCCTTGG - Intronic
1003284899 6:4725709-4725731 GAGGGAAGCAGCTCCAGCCTTGG + Intronic
1004697714 6:18049548-18049570 GACCTTAGGAGATCCTGCCTCGG - Intergenic
1005493966 6:26372811-26372833 GAGCTGAGCAGCTAAAGCTTGGG + Intronic
1005856034 6:29863997-29864019 GAGCTCAGCAGCTCCTCCCACGG + Intergenic
1005896678 6:30185024-30185046 GAGCAGAACCTCTCCTGCCTCGG - Exonic
1006405749 6:33843772-33843794 CAGCTGAGCAGTTGCTGCCAGGG - Intergenic
1006520576 6:34568836-34568858 GAGCTGGGCAGGTGCTGCCTGGG - Intergenic
1007075801 6:39065458-39065480 GAGCTGAGGAGCCCCTGCCTTGG + Intronic
1007239112 6:40412407-40412429 GAGCTGTGCAGCCCCAGGCTAGG - Intronic
1007577814 6:42937538-42937560 GAGCTGAGACGCTCCAACCTGGG + Intronic
1007686426 6:43669836-43669858 GAGCTGGGCTGCTCCTGTGTGGG + Intronic
1008843140 6:55928660-55928682 GAACTCAGCAGCCCCTGCCTTGG - Intergenic
1009985714 6:70779089-70779111 GACCTGAGAACCGCCTGCCTGGG - Intronic
1011277548 6:85644136-85644158 GCGAGGAGCGGCTCCTGCCTTGG + Intergenic
1012790845 6:103693767-103693789 GAGCTCAGAAACTCCTGCCTTGG + Intergenic
1013126457 6:107189276-107189298 GAGCTCAAGTGCTCCTGCCTTGG + Intronic
1013426223 6:110015419-110015441 GAGGTGAGCACCTCCTGCTCGGG + Intergenic
1013974429 6:116060552-116060574 GAGCTGGGCAGCTGCTCACTAGG + Exonic
1017903075 6:158734849-158734871 GAGCTGTGAAGCACCTGCCTTGG - Intronic
1017988754 6:159468179-159468201 GAGCTATGGAGCCCCTGCCTGGG - Intergenic
1018395911 6:163377911-163377933 AAGCTGAGCACCTCCTTCCCTGG + Intergenic
1018769142 6:166956694-166956716 CCGCGGAGCTGCTCCTGCCTCGG - Exonic
1019201457 6:170319612-170319634 GAGCTGAGATTCTCCAGCCTGGG + Intronic
1020221007 7:6237113-6237135 AACCAGAGCAGCTCCCGCCTCGG + Intronic
1020511347 7:9061073-9061095 GTGCTGAGCAACTCCTTCCAGGG + Intergenic
1021181173 7:17507772-17507794 GAGCAGGGCAACTCTTGCCTGGG - Intergenic
1023038331 7:36152619-36152641 CAGCTGAGCAGATCTCGCCTCGG + Intergenic
1023125441 7:36950191-36950213 GAGATGAGCGACTCCTGACTGGG + Intronic
1026226127 7:68442969-68442991 GACCTGAGCTGCTCCTGCCCTGG + Intergenic
1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG + Intronic
1028485843 7:91356294-91356316 GAGCTCAGCAGCTCCAGCTCTGG - Intergenic
1029267964 7:99357397-99357419 GAGCTCAGGAGTTCCAGCCTGGG - Intronic
1029447270 7:100620806-100620828 GAGCAGAGGAGCTCTTGACTGGG + Exonic
1030710572 7:112744027-112744049 GAGTTGAGCTGCTGCAGCCTGGG + Intergenic
1032095749 7:128937892-128937914 GAGCTCAGCAGCAGCTGCCCAGG + Intronic
1032169905 7:129576025-129576047 TTGCTGGGCAGCTCCTGCCAAGG - Intergenic
1032803296 7:135333656-135333678 GAGAGCAGCAGCTCCTGCTTTGG - Intergenic
1033132161 7:138753937-138753959 CAGCTGAGCAGCTTCTGCAGGGG - Intronic
1033367999 7:140685771-140685793 CAGCTGCTCTGCTCCTGCCTTGG + Intronic
1034272292 7:149809112-149809134 AGGCTGCGCAGCTGCTGCCTCGG - Intergenic
1035247536 7:157573645-157573667 TAGCTGGTCAGCTCCTGCTTTGG + Intronic
1035263410 7:157675596-157675618 GAGGGGAGCAGCTCATGCCGAGG + Intronic
1036245133 8:7109602-7109624 GAGCTTACCATCTCCTGGCTTGG - Intergenic
1037578559 8:20230824-20230846 GGCATGAGCAGCTGCTGCCTGGG - Intergenic
1037876867 8:22552697-22552719 CAGCTCAGCAGCTGCCGCCTGGG - Intronic
1038394032 8:27233424-27233446 CAGCTGTGCAGCTCCTCCCCTGG - Intergenic
1039080854 8:33732795-33732817 GAGTGGAGCAGCTCCTGACAAGG - Intergenic
1043479781 8:80641317-80641339 GCCCTGAGCCGCTCCTGCCCTGG - Exonic
1045173496 8:99696340-99696362 GAGCTGAAGCGCTACTGCCTTGG + Intronic
1045502562 8:102754444-102754466 TGGCTGAGCAGCTCCTGGGTTGG - Intergenic
1047247876 8:123160527-123160549 GGGCTGGGCTGATCCTGCCTTGG + Intergenic
1047640101 8:126809772-126809794 CAGGTGAGCAGCTCATGCTTAGG + Intergenic
1048390100 8:133954769-133954791 GAGCAGAGCTGCCCCTGACTTGG + Intergenic
1048906774 8:139096381-139096403 AAGCAGAGCGGCTCCTTCCTGGG - Intergenic
1049893771 9:95387-95409 GAGGAGAACAGCTTCTGCCTTGG + Intergenic
1053321860 9:37105803-37105825 GAGCTTAACAGGACCTGCCTTGG + Intergenic
1053600204 9:39602526-39602548 GGGCAGGGCACCTCCTGCCTGGG + Intergenic
1053857858 9:42356382-42356404 GGGCAGGGCACCTCCTGCCTGGG + Intergenic
1054253322 9:62739858-62739880 GGGCAGGGCACCTCCTGCCTGGG - Intergenic
1054567439 9:66774357-66774379 GGGCAGGGCACCTCCTGCCTGGG - Intergenic
1056959191 9:91106554-91106576 GAGCAGAGCAGATCCCGACTTGG + Intergenic
1057118121 9:92545233-92545255 AACCTGAGCGGCTCCGGCCTCGG - Intronic
1057222945 9:93267596-93267618 GAGCTGTCCAGCCCCTGTCTTGG + Intronic
1059433049 9:114261217-114261239 GTGGGGAGGAGCTCCTGCCTGGG - Intronic
1060735091 9:126061681-126061703 GAGCAGAGCAGCGTGTGCCTAGG + Intergenic
1061118709 9:128630102-128630124 GAGATGGGAAGCTGCTGCCTTGG - Intronic
1061360217 9:130136825-130136847 GAGGTGAGCAGCTGTGGCCTGGG - Exonic
1061905573 9:133694942-133694964 GAGGTGAGCAGCAGGTGCCTGGG + Intronic
1062175514 9:135159950-135159972 GAGCTGGGCAGTGCCTGCCCTGG - Intergenic
1062380475 9:136284475-136284497 GACCTGAGCAGCTGCTTCCCAGG - Intronic
1062467740 9:136688513-136688535 GGGCTCAGCAGCCCCTGCCCAGG + Intergenic
1185986568 X:4841536-4841558 GAGCTGTCCAGCTGCTGCCCAGG - Intergenic
1190278163 X:48912439-48912461 GAGCTCAGGAGTTCCAGCCTGGG + Intergenic
1191603934 X:63041436-63041458 TAGCTCCACAGCTCCTGCCTTGG - Intergenic
1192075943 X:67996692-67996714 GAGCTCAGGAACTCCAGCCTGGG - Intergenic
1193487377 X:82103176-82103198 GAGCTGTGCAGCTTGGGCCTAGG + Intergenic
1197118363 X:122860767-122860789 TATCTGAGCAGCTCCTTCCTGGG + Intergenic
1199570331 X:149261162-149261184 CAGCAGAGATGCTCCTGCCTCGG + Intergenic