ID: 1132913641

View in Genome Browser
Species Human (GRCh38)
Location 16:2329618-2329640
Sequence CAGGCTGCAGGGCAGTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2603
Summary {0: 1, 1: 0, 2: 11, 3: 194, 4: 2397}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132913628_1132913641 26 Left 1132913628 16:2329569-2329591 CCAGGGCTGGGAGAGAAGGTCAG 0: 1
1: 0
2: 3
3: 36
4: 464
Right 1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG 0: 1
1: 0
2: 11
3: 194
4: 2397
1132913632_1132913641 -10 Left 1132913632 16:2329605-2329627 CCCCCTTCCCACACAGGCTGCAG 0: 1
1: 0
2: 5
3: 50
4: 539
Right 1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG 0: 1
1: 0
2: 11
3: 194
4: 2397
1132913631_1132913641 -9 Left 1132913631 16:2329604-2329626 CCCCCCTTCCCACACAGGCTGCA 0: 1
1: 0
2: 6
3: 53
4: 534
Right 1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG 0: 1
1: 0
2: 11
3: 194
4: 2397
1132913630_1132913641 -6 Left 1132913630 16:2329601-2329623 CCACCCCCCTTCCCACACAGGCT 0: 1
1: 0
2: 3
3: 79
4: 798
Right 1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG 0: 1
1: 0
2: 11
3: 194
4: 2397
1132913627_1132913641 27 Left 1132913627 16:2329568-2329590 CCCAGGGCTGGGAGAGAAGGTCA 0: 1
1: 0
2: 2
3: 35
4: 359
Right 1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG 0: 1
1: 0
2: 11
3: 194
4: 2397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132913641 Original CRISPR CAGGCTGCAGGGCAGTACCA GGG Intronic
Too many off-targets to display for this crispr