ID: 1132915742

View in Genome Browser
Species Human (GRCh38)
Location 16:2342125-2342147
Sequence CCCGGGGCGTTGCATTAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132915742_1132915762 23 Left 1132915742 16:2342125-2342147 CCGACCTAATGCAACGCCCCGGG No data
Right 1132915762 16:2342171-2342193 CCAAGAGTCCTGATGGAGTAGGG No data
1132915742_1132915760 22 Left 1132915742 16:2342125-2342147 CCGACCTAATGCAACGCCCCGGG No data
Right 1132915760 16:2342170-2342192 CCCAAGAGTCCTGATGGAGTAGG No data
1132915742_1132915755 16 Left 1132915742 16:2342125-2342147 CCGACCTAATGCAACGCCCCGGG No data
Right 1132915755 16:2342164-2342186 CCCACCCCCAAGAGTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132915742 Original CRISPR CCCGGGGCGTTGCATTAGGT CGG (reversed) Intergenic
No off target data available for this crispr