ID: 1132920129

View in Genome Browser
Species Human (GRCh38)
Location 16:2384686-2384708
Sequence CTTGTTCCTGATCTTTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132920123_1132920129 20 Left 1132920123 16:2384643-2384665 CCAGTAGAATGTTGAATAAAGTG No data
Right 1132920129 16:2384686-2384708 CTTGTTCCTGATCTTTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132920129 Original CRISPR CTTGTTCCTGATCTTTGTGG GGG Intergenic
No off target data available for this crispr