ID: 1132920316

View in Genome Browser
Species Human (GRCh38)
Location 16:2386196-2386218
Sequence TGCGGCTCATGCCCCCGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 2, 2: 0, 3: 7, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132920316_1132920317 -10 Left 1132920316 16:2386196-2386218 CCTGAGCGGGGGCATGAGCCGCA 0: 1
1: 2
2: 0
3: 7
4: 117
Right 1132920317 16:2386209-2386231 ATGAGCCGCAAGCTCTCCATCGG 0: 1
1: 1
2: 0
3: 5
4: 61
1132920316_1132920325 24 Left 1132920316 16:2386196-2386218 CCTGAGCGGGGGCATGAGCCGCA 0: 1
1: 2
2: 0
3: 7
4: 117
Right 1132920325 16:2386243-2386265 TCGCAGGCTCCAAGGTGCGGCGG 0: 1
1: 1
2: 0
3: 0
4: 90
1132920316_1132920324 21 Left 1132920316 16:2386196-2386218 CCTGAGCGGGGGCATGAGCCGCA 0: 1
1: 2
2: 0
3: 7
4: 117
Right 1132920324 16:2386240-2386262 TCATCGCAGGCTCCAAGGTGCGG No data
1132920316_1132920320 8 Left 1132920316 16:2386196-2386218 CCTGAGCGGGGGCATGAGCCGCA 0: 1
1: 2
2: 0
3: 7
4: 117
Right 1132920320 16:2386227-2386249 ATCGGCATCGCCCTCATCGCAGG No data
1132920316_1132920321 16 Left 1132920316 16:2386196-2386218 CCTGAGCGGGGGCATGAGCCGCA 0: 1
1: 2
2: 0
3: 7
4: 117
Right 1132920321 16:2386235-2386257 CGCCCTCATCGCAGGCTCCAAGG No data
1132920316_1132920327 28 Left 1132920316 16:2386196-2386218 CCTGAGCGGGGGCATGAGCCGCA 0: 1
1: 2
2: 0
3: 7
4: 117
Right 1132920327 16:2386247-2386269 AGGCTCCAAGGTGCGGCGGTGGG 0: 1
1: 1
2: 0
3: 6
4: 67
1132920316_1132920326 27 Left 1132920316 16:2386196-2386218 CCTGAGCGGGGGCATGAGCCGCA 0: 1
1: 2
2: 0
3: 7
4: 117
Right 1132920326 16:2386246-2386268 CAGGCTCCAAGGTGCGGCGGTGG 0: 1
1: 1
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132920316 Original CRISPR TGCGGCTCATGCCCCCGCTC AGG (reversed) Intergenic