ID: 1132921296

View in Genome Browser
Species Human (GRCh38)
Location 16:2395880-2395902
Sequence GAGCTGGGCATCTCCAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132921290_1132921296 21 Left 1132921290 16:2395836-2395858 CCAGGTTTGAATCTCTATTTACT 0: 1
1: 0
2: 0
3: 22
4: 211
Right 1132921296 16:2395880-2395902 GAGCTGGGCATCTCCAGCTTTGG 0: 1
1: 0
2: 1
3: 34
4: 188
1132921289_1132921296 25 Left 1132921289 16:2395832-2395854 CCTTCCAGGTTTGAATCTCTATT 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1132921296 16:2395880-2395902 GAGCTGGGCATCTCCAGCTTTGG 0: 1
1: 0
2: 1
3: 34
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132921296 Original CRISPR GAGCTGGGCATCTCCAGCTT TGG Intergenic
900827181 1:4936070-4936092 CAGCTGGGCATGTCCTGGTTTGG - Intergenic
900831973 1:4971921-4971943 GAACTGAGCCTCTCCTGCTTAGG + Intergenic
902310038 1:15575164-15575186 GAACTGGGTATTTCCACCTTGGG - Intronic
904655431 1:32042210-32042232 GTGTTGGGTATCTCCAGGTTTGG + Intronic
905897663 1:41559031-41559053 CAGCTGGGCCTGTCCATCTTGGG + Intronic
906531849 1:46528255-46528277 CATCTGGCCATCTCCTGCTTTGG + Intergenic
907459323 1:54595978-54596000 GAGCTGGGCCTCCCCAGCTCCGG - Intronic
908000029 1:59670794-59670816 GAGCGGGGCCTTGCCAGCTTGGG + Intronic
908793990 1:67813078-67813100 GAGCTTGCCATCTGGAGCTTTGG - Intronic
911466987 1:98267558-98267580 GAGCTGAGCATCTTCAGCTCTGG - Intergenic
912755211 1:112318806-112318828 GTGTTGGGCATATCCAGCCTGGG - Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
914767809 1:150654691-150654713 AACCGGGGCATTTCCAGCTTAGG + Intronic
915322182 1:155062154-155062176 GTGCTGGGGAACACCAGCTTGGG - Intronic
915776286 1:158491252-158491274 GTGCTGGGCTTCTCTAGCCTTGG + Intergenic
915776332 1:158491798-158491820 GAACTGGTCATCTTCATCTTCGG + Intergenic
916508041 1:165445622-165445644 GAGGTGGGCCTCTCCTGCTTGGG + Intergenic
916880207 1:169013318-169013340 GGGCTGGGCGGCTCCACCTTAGG - Intergenic
917095188 1:171392687-171392709 CAGCTGGGCAGCTCCAGGTCAGG - Intergenic
917630787 1:176889333-176889355 GAGCTCAACATCTGCAGCTTTGG + Intronic
917669068 1:177255774-177255796 GCTCTGGGCACCTCCAGCTGAGG + Intronic
918591343 1:186244970-186244992 GAGATGGGCTCCTACAGCTTTGG + Intergenic
919859727 1:201731550-201731572 TTGTGGGGCATCTCCAGCTTGGG + Intronic
920054145 1:203180579-203180601 GTGATGGGCATCCCCACCTTCGG - Exonic
921096816 1:211893843-211893865 GAGCTGGGAAGTACCAGCTTTGG + Intergenic
921278390 1:213541896-213541918 GAGCAGGGAATCTCCAGTTTTGG + Intergenic
921674789 1:217965498-217965520 CAGCTGGGCACCTGCAGCCTGGG + Intergenic
922857846 1:228790367-228790389 GAGCTGAGCAGCTCCAGCTGGGG + Intergenic
1063018066 10:2097966-2097988 GAGTTGGCAATATCCAGCTTGGG + Intergenic
1063078235 10:2738308-2738330 GGGCTCTGCAGCTCCAGCTTTGG - Intergenic
1065780695 10:29163941-29163963 GAACTGGGGATTTCCAGATTTGG - Intergenic
1066069760 10:31795610-31795632 GACTTGGGCATCTGCAGATTGGG - Intergenic
1066584525 10:36918042-36918064 GAGCAGGGCATCTCAAACTGAGG + Intergenic
1069841010 10:71339463-71339485 GAGCTGGGCCTCTCCCACGTGGG + Intronic
1071943389 10:90613337-90613359 GTCATGAGCATCTCCAGCTTAGG + Intergenic
1072134613 10:92533092-92533114 TATCTGGGCCTATCCAGCTTTGG - Intronic
1073096407 10:100982960-100982982 GTGCTGGGCATCTCCACATGAGG - Intronic
1073443281 10:103565229-103565251 GTGCTGGGCATCTCCTGCCATGG - Intronic
1073792609 10:106955350-106955372 GGGGTGGGCAGCTCCAGCATTGG - Intronic
1075818871 10:125288203-125288225 GATTTGGGAATCTCCAGCCTGGG + Intergenic
1076694213 10:132239342-132239364 GAGATGGGCTCCCCCAGCTTGGG - Intronic
1076696166 10:132248419-132248441 GAGCTGGCCGCCTACAGCTTGGG + Intronic
1076895562 10:133309575-133309597 GCGCTGTGCCTGTCCAGCTTTGG + Intronic
1079249821 11:18779238-18779260 GATCTTGGCATCTTCAGGTTTGG + Intronic
1079750477 11:24190759-24190781 GAGGTGGGCTCCTCCAGATTTGG + Intergenic
1082735771 11:56854089-56854111 GGGCAGGGCATCACCAGCTAAGG + Intergenic
1082787268 11:57324121-57324143 GGGCTGGGCAGCTCCAGCCCCGG + Intronic
1083343433 11:61973576-61973598 GAGCTGGGCCTCCCCTGATTTGG - Intergenic
1083428619 11:62602268-62602290 GAGCCGGGCAGCCCCAGCCTAGG - Exonic
1083897154 11:65625568-65625590 GGGAGGGGCATGTCCAGCTTGGG + Intronic
1087480464 11:98693605-98693627 GAGTTGGGCTCCTACAGCTTTGG - Intergenic
1089365503 11:117918685-117918707 GGGCCGGGCATCTCCAGCCCAGG - Exonic
1091296911 11:134480390-134480412 GAGCAGGGATTCACCAGCTTAGG - Intergenic
1092868477 12:12785070-12785092 GTTTTGGGCATCTCCAGCTGTGG - Intronic
1096541140 12:52307999-52308021 GAGCTGTGCAACCCCAGCTTGGG - Intronic
1102217685 12:111173167-111173189 GAGCTGGGCATCTACTGCGTGGG + Intronic
1103418769 12:120763105-120763127 GACCTGGTCATCTGCAGCTCTGG - Exonic
1103906533 12:124330523-124330545 GACATGTGCATCTCCAGCTGAGG + Intronic
1105380922 13:19886689-19886711 CACCTGGGCAACTCCAGCCTGGG - Intergenic
1105446683 13:20463063-20463085 GAGGTGGGCAGACCCAGCTTCGG - Intronic
1118468498 14:66053449-66053471 GAGCCCGGCCTCTCAAGCTTTGG + Intergenic
1119472192 14:74907144-74907166 CAGCTGGGCCACTCCAGCTGTGG + Intronic
1121027585 14:90627885-90627907 GACCAGGTCATCTCCAGCTTAGG - Intronic
1122605610 14:102945633-102945655 GAGCAGGGCGTTTCCAGCCTGGG - Intronic
1122623825 14:103074198-103074220 GCTCTGGGCTTCTCCAGCTGTGG + Intergenic
1122932648 14:104941790-104941812 AAACTGGGCATCTCCACCTTGGG + Exonic
1122932761 14:104942285-104942307 AAACTGGGCATCTGCAGCTTCGG + Exonic
1122932992 14:104943275-104943297 AAACTGGGCATCTGCACCTTGGG + Exonic
1122933109 14:104943770-104943792 AAACTGGGCATCTGCACCTTGGG + Exonic
1122933219 14:104944265-104944287 AAACTGGGCATCTCCACCTTGGG + Exonic
1122933336 14:104944760-104944782 AAACTGGGCATCTCCACTTTGGG + Exonic
1122933456 14:104945255-104945277 AAACTGGGCATCTCCACCTTGGG + Exonic
1122933573 14:104945750-104945772 AAACTGGGCATCTGCAACTTGGG + Exonic
1122933686 14:104946245-104946267 AAACTGGGCATCTGCAACTTGGG + Exonic
1122933802 14:104946740-104946762 AAACTGGGCATCTGCACCTTGGG + Exonic
1122933918 14:104947235-104947257 AAACTGGGCATCTGCAGCTTGGG + Exonic
1122934031 14:104947730-104947752 AAACTGGGCATCTGCACCTTGGG + Exonic
1122934151 14:104948225-104948247 AAACTGGGCATCTGCAGCTTGGG + Exonic
1122934265 14:104948720-104948742 AAACTGGGCATCTGCAGCTTGGG + Exonic
1122934380 14:104949215-104949237 AAACTGGGCATCTCCACCTTGGG + Exonic
1122934498 14:104949710-104949732 AAACTGGGCATATCCACCTTGGG + Exonic
1122934618 14:104950205-104950227 AAACTGGGCATCTGCACCTTGGG + Exonic
1122934849 14:104951195-104951217 AAACTGGGCATCTGCAGCTTGGG + Exonic
1122935084 14:104952185-104952207 AAACTGGGCATCTCCACCTTGGG + Exonic
1122935203 14:104952680-104952702 AAACTGGGCATCTCCACTTTGGG + Exonic
1123475773 15:20591991-20592013 GACCTGGGCAGCTCCAGTGTGGG - Intergenic
1123642237 15:22408372-22408394 GACCTGGGCAGCTCCAGTGTGGG + Intergenic
1124065884 15:26343212-26343234 GTGATGGGCATCTTCTGCTTTGG + Intergenic
1125186663 15:36938859-36938881 GGGCTGGACATCAGCAGCTTGGG - Intronic
1125764380 15:42123492-42123514 GAGCTGGGAAACTCCAGCCCAGG + Intergenic
1129494114 15:75960433-75960455 CAGCTGGGCATCTTTTGCTTGGG + Intronic
1129904735 15:79178492-79178514 AAGAAGGGCATCTCCAGCTTAGG - Intergenic
1130085602 15:80776676-80776698 GAATTGGGCATCTCCACCCTTGG - Intergenic
1131651689 15:94406613-94406635 GGGCTGGGCATTTCCATGTTTGG - Intronic
1132907800 16:2292176-2292198 GAGCTGGGCATTGCCAGCTTTGG - Exonic
1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG + Intronic
1132921296 16:2395880-2395902 GAGCTGGGCATCTCCAGCTTTGG + Intergenic
1135410255 16:22228751-22228773 AAGCTGGACAGCTCGAGCTTCGG + Intronic
1137752954 16:50880216-50880238 GAGCAGGGCTTCTCTACCTTGGG + Intergenic
1138222768 16:55267045-55267067 GACCCTGGCATCTTCAGCTTTGG - Intergenic
1139949465 16:70662110-70662132 GAGCTGGGCAGCTCCTGGGTAGG - Exonic
1147637564 17:41973429-41973451 GAGCCTGCCATCTCTAGCTTGGG + Intronic
1147667727 17:42159437-42159459 GAGGTGAGCCTCTCCAGCCTGGG + Intronic
1147935298 17:44007403-44007425 GACCTGGTCAACGCCAGCTTCGG + Exonic
1150885987 17:69086291-69086313 GAGCTGAGCAGCGCCAGATTAGG - Intronic
1151057359 17:71049004-71049026 GGCGTGGGCATCTCAAGCTTAGG - Intergenic
1151653969 17:75486839-75486861 GAGCTGGGCTGCTCCATCTCAGG - Intronic
1151726901 17:75890703-75890725 GAGCTGCCCAGCTTCAGCTTGGG - Exonic
1152112211 17:78363235-78363257 GAGCTGAGCTGCTGCAGCTTGGG + Intergenic
1154139107 18:11807668-11807690 CAAATGGACATCTCCAGCTTAGG - Intronic
1154161942 18:11987095-11987117 GAGCAGTGCTTCTCCAGCTTTGG + Intronic
1155353217 18:24926821-24926843 GAGCAGGGCATTTTCAGCTTGGG + Intergenic
1156454359 18:37284647-37284669 GGGCAGGGCATCTCAAGCTCGGG - Intronic
1160223828 18:76997315-76997337 GAGCTGGGAAGCTCCAGCCCGGG + Intronic
1161018135 19:1993494-1993516 GAGCTGGGTGTCTCCTTCTTGGG + Intronic
1161335071 19:3708609-3708631 GAGCTGGCCTTCCCCAGCTGAGG + Intronic
1162073584 19:8169740-8169762 AACCTGGCCATCTCCAGCCTGGG + Intronic
1163470477 19:17493984-17494006 GGGCTGGGCATGTCCACCCTGGG - Intronic
1167118068 19:47499602-47499624 CAGCTGGGCATCTCATGCGTTGG - Intronic
925032887 2:665146-665168 GAGCTGGGCGTCTGCATCTCTGG - Intergenic
925032997 2:665955-665977 GAGCTGGGCATCCGCATCTCTGG - Intergenic
925033006 2:666014-666036 GAGCTGAGCATCTGCATCTCGGG - Intergenic
925879102 2:8336020-8336042 GAGCTGAGCAGTTCCAGCATAGG + Intergenic
926809031 2:16740216-16740238 CAGCTGGGCACCTCCAGCGTGGG - Intergenic
927860110 2:26555450-26555472 GAACAGGGCAGCACCAGCTTAGG + Intronic
930076207 2:47407615-47407637 GAGCTGGGCAACCACAGCCTTGG - Intronic
931986955 2:67751421-67751443 CACCTGCGCATGTCCAGCTTAGG - Intergenic
932624201 2:73284700-73284722 GCCCTGGGCACCTCCAGCTGTGG + Intergenic
936499847 2:113058630-113058652 GAGGTGGGACTCTCCTGCTTAGG - Intronic
939641114 2:144640901-144640923 GAGCTGGGCACTACCAGGTTTGG + Intergenic
941307712 2:163891965-163891987 GAGGTGGGCTTCCACAGCTTTGG + Intergenic
943792023 2:191944016-191944038 ACCCTGGGCTTCTCCAGCTTAGG + Intergenic
945524469 2:210871121-210871143 GAGCAGGCCATCTACAGATTTGG + Intergenic
948738984 2:240030693-240030715 GAGCCGGGCAGCTCCAGGGTGGG + Intergenic
1169816256 20:9660069-9660091 GAAGTGGGCATCTTCAGATTTGG - Intronic
1170322147 20:15111825-15111847 GAGCTGGGCACCTCCCAGTTAGG - Intronic
1172389080 20:34553998-34554020 GACATGGGCATCTTCAGTTTGGG + Intronic
1173463194 20:43260464-43260486 ATGCTGGGCTTCTCCATCTTGGG + Intergenic
1179044032 21:37829400-37829422 GAGCTGGGGGCCTCCAGCTTTGG + Intronic
1179534785 21:42044416-42044438 GAGCTGGTGGTCTCCAGCATTGG + Intergenic
1182503255 22:30764079-30764101 GAGCTGGCCACCTCCCTCTTGGG + Intronic
950094479 3:10320941-10320963 GAGCTGAACGGCTCCAGCTTGGG + Intronic
950521761 3:13501697-13501719 GAGCTGTGCAGCTCCAGCTGTGG - Intronic
951773440 3:26283527-26283549 GAGGTGGGCTTCCACAGCTTTGG + Intergenic
953871747 3:46633035-46633057 GAGCTGCCCCTCTCCAGCCTTGG + Intergenic
953960612 3:47263250-47263272 CAGCTGAGCACCTCCAGCTTGGG - Intronic
954715854 3:52526413-52526435 GAGCTGGGCTTCTTCAGGCTAGG - Intronic
957457376 3:80469248-80469270 GAGCAGGGGATATCCAGATTTGG - Intergenic
959615417 3:108342010-108342032 GAGATGAGCATGTCCGGCTTGGG - Intronic
960954627 3:123023476-123023498 GATCTGGGCATCTGGAGCTCTGG - Intronic
963466099 3:145684978-145685000 CAGCTGGGCAGCTCCAGGTAAGG - Intergenic
964675241 3:159271122-159271144 GAACTGGGCATCTACAGCTCAGG - Intronic
966660685 3:182411231-182411253 GAGCTGGGCCTGTCCAGAGTTGG + Intergenic
967967343 3:194972382-194972404 GAGCTGGACAGTTCCTGCTTGGG - Intergenic
968563577 4:1297414-1297436 GGGCTGGCCATTTCTAGCTTTGG + Intronic
969365553 4:6692303-6692325 GAGCTGGGCAGTTCCCTCTTGGG - Intergenic
969683655 4:8657040-8657062 CAGCTGGGCTTCCCGAGCTTGGG + Intergenic
971175751 4:24280956-24280978 ATGCTGGGCTTCTCCAGCTTTGG - Intergenic
972080346 4:35141722-35141744 AACCTGGGCATTTCCAGCTCAGG + Intergenic
974748214 4:66103196-66103218 GAGGTGGGCTCCTACAGCTTTGG - Intergenic
976977791 4:91185575-91185597 AACCTGGGCATTTCCAGCTCAGG - Intronic
977135609 4:93299958-93299980 GACTTGGGCATCTGCAGATTTGG - Intronic
982925232 4:161328602-161328624 GAGCTGGTCATCCACAGCTCAGG - Intergenic
997228941 5:132228837-132228859 AGGCTGGGCATCTCCCGCTCTGG - Intronic
997352599 5:133241656-133241678 TAGCTTGGCATCCCCAGCTGGGG + Intronic
999204529 5:149838576-149838598 GACCAGGGAAGCTCCAGCTTGGG - Intronic
999251474 5:150184908-150184930 GAGAAGGGCATCTCCAGGGTAGG + Intergenic
999309437 5:150542484-150542506 GAGCTGGTCCTTTCCAGCTCTGG - Intronic
1002334127 5:178466437-178466459 GAGCTGGGACCTTCCAGCTTAGG - Intronic
1002823696 6:753684-753706 GTGCTGGGCATCTACTGTTTGGG + Intergenic
1003312105 6:4978388-4978410 AAGCTAAGCTTCTCCAGCTTGGG + Intergenic
1003535375 6:6971295-6971317 GAGCTCGGCTTCTCCACCTGTGG - Intergenic
1005493966 6:26372811-26372833 GAGCTGAGCAGCTAAAGCTTGGG + Intronic
1005787808 6:29264003-29264025 GAGATGATCATCTCCAGCTGAGG + Intergenic
1005816942 6:29561151-29561173 GAGTTGGGTATTTCCAGCATGGG + Intronic
1005855948 6:29863586-29863608 AACCTGGGCGTCTCCAGCTCTGG + Intergenic
1007502946 6:42312613-42312635 GGTCTGGGCATCTGCACCTTCGG + Intronic
1007815511 6:44522406-44522428 GAGCTGGGTATCTTCAGCTGTGG - Intergenic
1010525294 6:76894017-76894039 GAGGTGGGCACCCACAGCTTTGG + Intergenic
1013908502 6:115246295-115246317 AAGCTGAGCTTCTCCAGGTTAGG - Intergenic
1014721208 6:124920464-124920486 GAGTTGGGCACCCACAGCTTTGG + Intergenic
1015369931 6:132439241-132439263 GAGCTGGGCATTTCTTGGTTTGG + Intergenic
1018730263 6:166644922-166644944 GAGCGGGGCATCTCCAAACTAGG + Intronic
1019201457 6:170319612-170319634 GAGCTGAGATTCTCCAGCCTGGG + Intronic
1019755068 7:2762844-2762866 GAGCTGGCCCTCTCCTGCTTCGG - Intronic
1026104960 7:67413575-67413597 GAGCTGGGCAGGGCCAGCTGTGG + Intergenic
1026450586 7:70525828-70525850 GAGATGGGCACCTCCAGCCTTGG + Intronic
1028485843 7:91356294-91356316 GAGCTCAGCAGCTCCAGCTCTGG - Intergenic
1028909607 7:96193498-96193520 GATCTGGCCAACCCCAGCTTAGG + Intronic
1034460264 7:151194152-151194174 GAGGTGGACATGTCCAGCCTGGG - Intronic
1035247536 7:157573645-157573667 TAGCTGGTCAGCTCCTGCTTTGG + Intronic
1036244955 8:7108130-7108152 GATCTGGGAATGTCCAGCTGGGG + Intergenic
1036896866 8:12643327-12643349 GATCTGGGAATGTCCAGCTGGGG - Intergenic
1037402138 8:18503962-18503984 TTGCTGGGCATTTCCAGTTTGGG - Intergenic
1037887412 8:22602220-22602242 GCACTGGGCACCTCCACCTTTGG - Exonic
1039819327 8:41122287-41122309 GATCTGGGGAGCCCCAGCTTGGG - Intergenic
1039870113 8:41539026-41539048 TAACTGGTCATCACCAGCTTTGG - Intronic
1041018984 8:53619052-53619074 AACCTGGGCATTTCCAGCTCAGG + Intergenic
1042732466 8:71952196-71952218 GAGCTGAGCAACTGCAGCTGGGG - Intronic
1044205842 8:89491121-89491143 GAGGTGGGCTTCTACAGCCTTGG - Intergenic
1046628212 8:116597852-116597874 CAGATGGGCAGTTCCAGCTTTGG + Intergenic
1047212237 8:122849278-122849300 GAGCTGGGAATGTCTAGCTCCGG - Intronic
1048731742 8:137449609-137449631 GATCTTGGTATCTCCAGCATAGG - Intergenic
1049595935 8:143483397-143483419 GGGCTGGGCCTCTCCAGCCAAGG - Intronic
1053487342 9:38469924-38469946 CAGCTGGTCAGCTCCATCTTGGG + Intergenic
1055280247 9:74665994-74666016 TAGCTGGGCATCACCAGGTGTGG + Intronic
1056581501 9:87890243-87890265 GACCTGGGCAGCTCCAGTGTGGG + Intergenic
1059504071 9:114781985-114782007 GAGCTGGGGCTCCCCAGGTTGGG + Intergenic
1060212671 9:121720092-121720114 CAGCTGGGCAGCTCCAACTCTGG + Intronic
1060276989 9:122189953-122189975 GAGATGTCCATCTCCAGCATGGG + Intronic
1060402860 9:123358246-123358268 GAGCTGGGCCTCTCCATCCTGGG + Intronic
1061003333 9:127914993-127915015 GAGCTTGGCATCCCCAGGTAAGG - Intronic
1061236204 9:129344061-129344083 GAGCTGGGCTTTTCCAGCTCCGG - Intergenic
1187308458 X:18118581-18118603 CTGCTGGTCACCTCCAGCTTTGG + Intergenic
1187834522 X:23417877-23417899 GAGCTGGGCTTCTCAAACTCTGG + Intergenic
1191717484 X:64203817-64203839 CAGCTGGGCATCTCTAGCCCAGG - Intronic
1194182043 X:90723606-90723628 GAGCTGGCAAACTCCAGCTTGGG + Intergenic
1196061306 X:111410901-111410923 AAGGTTAGCATCTCCAGCTTAGG + Exonic
1196168934 X:112565837-112565859 AATCTTGGCAGCTCCAGCTTCGG - Intergenic
1198031643 X:132758967-132758989 GAGCTGGGCCCCTCCAACCTGGG + Intronic
1199419083 X:147622295-147622317 GATTTGGGCATCTTCAGATTTGG - Intergenic
1199747803 X:150784986-150785008 GAGGAGGGGATCTCCAGCATGGG + Intronic
1199800616 X:151247589-151247611 AAGCAGGGCTTCTCCAGCTAGGG + Intergenic
1200528675 Y:4305516-4305538 GAGCTGGCAAACTCCAGCTTGGG + Intergenic