ID: 1132922337

View in Genome Browser
Species Human (GRCh38)
Location 16:2404006-2404028
Sequence ATGGCAAAGTTCATTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132922337_1132922339 5 Left 1132922337 16:2404006-2404028 CCAAACAAAATGAACTTTGCCAT No data
Right 1132922339 16:2404034-2404056 TAAGAATTTGTTTTTGCTTTTGG No data
1132922337_1132922340 10 Left 1132922337 16:2404006-2404028 CCAAACAAAATGAACTTTGCCAT No data
Right 1132922340 16:2404039-2404061 ATTTGTTTTTGCTTTTGGTTTGG No data
1132922337_1132922342 17 Left 1132922337 16:2404006-2404028 CCAAACAAAATGAACTTTGCCAT No data
Right 1132922342 16:2404046-2404068 TTTGCTTTTGGTTTGGTTTAGGG No data
1132922337_1132922343 29 Left 1132922337 16:2404006-2404028 CCAAACAAAATGAACTTTGCCAT No data
Right 1132922343 16:2404058-2404080 TTGGTTTAGGGTTTGTATGTTGG 0: 1
1: 0
2: 1
3: 22
4: 288
1132922337_1132922341 16 Left 1132922337 16:2404006-2404028 CCAAACAAAATGAACTTTGCCAT No data
Right 1132922341 16:2404045-2404067 TTTTGCTTTTGGTTTGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132922337 Original CRISPR ATGGCAAAGTTCATTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr