ID: 1132924422

View in Genome Browser
Species Human (GRCh38)
Location 16:2421123-2421145
Sequence CTGTTTGAATAGGGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132924415_1132924422 7 Left 1132924415 16:2421093-2421115 CCTCAGGCAGTGGAGCCCAGGGT No data
Right 1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG No data
1132924411_1132924422 14 Left 1132924411 16:2421086-2421108 CCTCCAACCTCAGGCAGTGGAGC No data
Right 1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG No data
1132924416_1132924422 -8 Left 1132924416 16:2421108-2421130 CCCAGGGTTGTCCAGCTGTTTGA No data
Right 1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG No data
1132924408_1132924422 19 Left 1132924408 16:2421081-2421103 CCCATCCTCCAACCTCAGGCAGT No data
Right 1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG No data
1132924412_1132924422 11 Left 1132924412 16:2421089-2421111 CCAACCTCAGGCAGTGGAGCCCA No data
Right 1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG No data
1132924409_1132924422 18 Left 1132924409 16:2421082-2421104 CCATCCTCCAACCTCAGGCAGTG No data
Right 1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG No data
1132924406_1132924422 23 Left 1132924406 16:2421077-2421099 CCTTCCCATCCTCCAACCTCAGG No data
Right 1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG No data
1132924417_1132924422 -9 Left 1132924417 16:2421109-2421131 CCAGGGTTGTCCAGCTGTTTGAA No data
Right 1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132924422 Original CRISPR CTGTTTGAATAGGGAGAAGA GGG Intergenic
No off target data available for this crispr