ID: 1132925577

View in Genome Browser
Species Human (GRCh38)
Location 16:2427659-2427681
Sequence CCTGAAGCCCAGTGGGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132925569_1132925577 14 Left 1132925569 16:2427622-2427644 CCTAACAGTTTAGACTTTTCCAA No data
Right 1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG No data
1132925568_1132925577 22 Left 1132925568 16:2427614-2427636 CCTGAGCTCCTAACAGTTTAGAC No data
Right 1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG No data
1132925567_1132925577 23 Left 1132925567 16:2427613-2427635 CCCTGAGCTCCTAACAGTTTAGA No data
Right 1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG No data
1132925571_1132925577 -5 Left 1132925571 16:2427641-2427663 CCAACAAGGTCTCACCTTCCTGA No data
Right 1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132925577 Original CRISPR CCTGAAGCCCAGTGGGAAAC GGG Intergenic
No off target data available for this crispr