ID: 1132932249

View in Genome Browser
Species Human (GRCh38)
Location 16:2464629-2464651
Sequence ACGTGTCCTTACCATCCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132932243_1132932249 13 Left 1132932243 16:2464593-2464615 CCGGGCTGTGCACAGCCTGCTCT 0: 1
1: 0
2: 2
3: 36
4: 400
Right 1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1132932247_1132932249 -2 Left 1132932247 16:2464608-2464630 CCTGCTCTGCGAGGGAGGAGCAC 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1132932242_1132932249 19 Left 1132932242 16:2464587-2464609 CCTGTGCCGGGCTGTGCACAGCC 0: 1
1: 0
2: 2
3: 36
4: 267
Right 1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1132932240_1132932249 29 Left 1132932240 16:2464577-2464599 CCTGGCTGGCCCTGTGCCGGGCT 0: 1
1: 0
2: 2
3: 67
4: 398
Right 1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1132932239_1132932249 30 Left 1132932239 16:2464576-2464598 CCCTGGCTGGCCCTGTGCCGGGC 0: 1
1: 0
2: 2
3: 40
4: 421
Right 1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 53
1132932241_1132932249 20 Left 1132932241 16:2464586-2464608 CCCTGTGCCGGGCTGTGCACAGC 0: 1
1: 0
2: 0
3: 22
4: 215
Right 1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132932249 Original CRISPR ACGTGTCCTTACCATCCTGC GGG Exonic
900777739 1:4597097-4597119 ACCTGTCCCTTCCCTCCTGCCGG - Intergenic
901370278 1:8791389-8791411 ATGTGTCCCTACCCTCCTGGAGG - Intronic
920677712 1:208049560-208049582 GCTTGACATTACCATCCTGCTGG - Intronic
924464251 1:244285652-244285674 ACTTGCCCTTCCCTTCCTGCTGG - Intergenic
1072039065 10:91590487-91590509 ACATGCCCTCCCCATCCTGCGGG - Intergenic
1077490540 11:2859005-2859027 TCCCCTCCTTACCATCCTGCAGG + Intergenic
1077613638 11:3660149-3660171 AGGTGTCCTCACCAAACTGCTGG - Exonic
1085296506 11:75434597-75434619 ACTTGTCCCCACCCTCCTGCTGG + Intergenic
1085476168 11:76790257-76790279 AGGGCTCCTGACCATCCTGCAGG + Intronic
1088401548 11:109426238-109426260 GAGAGTCCTTACTATCCTGCAGG + Exonic
1095981234 12:47975910-47975932 AGGTGTCCCTACCATCCGGGAGG - Intronic
1107395064 13:40006785-40006807 AGATGACCTTACCATCTTGCTGG - Intergenic
1119796895 14:77406723-77406745 ACCTGTCCCTACAGTCCTGCTGG - Exonic
1123029211 14:105443169-105443191 ATGTGGCCTGACCCTCCTGCAGG - Intronic
1124369951 15:29098926-29098948 CCGTGCCCTGACCATCCTCCAGG + Intronic
1129893065 15:79084645-79084667 AAGTGTCCTTACCATACTAGAGG + Intronic
1132932249 16:2464629-2464651 ACGTGTCCTTACCATCCTGCGGG + Exonic
1143125026 17:4636506-4636528 ACCTGTCCTCTCCATCCTGATGG + Intronic
1143582972 17:7836989-7837011 CCGTGGTCTTAGCATCCTGCAGG + Intergenic
1156747959 18:40415443-40415465 AGGTGTCCTTTCCATCATTCTGG + Intergenic
1158195598 18:54881791-54881813 GCGTGTCCTATCCATCCTGCTGG + Intronic
1161666462 19:5579966-5579988 GCGTGTCCTTTCCTTCCTGGGGG + Intergenic
1162722505 19:12670664-12670686 ACCTGACCTCACCATCATGCTGG + Exonic
1163988331 19:20973210-20973232 ATGTGTCTATACCATCATGCAGG + Intergenic
1164100345 19:22049329-22049351 ACGAGTCCTTACCATCATGAAGG - Intergenic
1164646723 19:29863732-29863754 AAGTGTCCTTCCCCTCCTGCTGG + Intergenic
1166746369 19:45143724-45143746 TCCTGTCCTGCCCATCCTGCAGG + Intronic
1167461019 19:49624837-49624859 ACGTGTGCAGAGCATCCTGCGGG - Exonic
936748161 2:115606238-115606260 ACCTGTTCTTAAAATCCTGCAGG + Intronic
1172668982 20:36620936-36620958 ACGACTACTTACCATCCAGCAGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1185157972 22:49205577-49205599 ACGTGGCCTGACCTTCATGCTGG + Intergenic
953701598 3:45200164-45200186 GAGTGTCCTTACATTCCTGCGGG - Intergenic
955628621 3:60948154-60948176 AGGTGTCCTTCCTAGCCTGCAGG + Intronic
958076737 3:88690516-88690538 ACGTAGCCTTTCCAGCCTGCTGG + Intergenic
960952649 3:123009661-123009683 AAGTGACCTTGCAATCCTGCAGG + Intronic
962874687 3:139526904-139526926 ACCAGTACTTACCATTCTGCTGG - Intronic
966354253 3:179062289-179062311 TCCTGTCCTTAGCATTCTGCAGG - Intronic
967999678 3:195196295-195196317 AAGTGGCCTTGCCATCCTGCAGG + Intronic
970363359 4:15332991-15333013 ACATGTCCAGACTATCCTGCTGG + Intergenic
970574968 4:17418232-17418254 ACCTGTGCTTTCCACCCTGCTGG + Intergenic
987764898 5:22213540-22213562 ATGTGCCGTTACCAACCTGCTGG + Intronic
991899634 5:71446686-71446708 ATGTGCCGTTACCAACCTGCTGG + Intergenic
1000022871 5:157333699-157333721 GCATGTCCTTAGGATCCTGCAGG + Intronic
1001249152 5:170132791-170132813 AGATGTCATCACCATCCTGCTGG - Intergenic
1002107738 5:176888525-176888547 CCGTGTCCATGCTATCCTGCAGG - Exonic
1002570959 5:180139135-180139157 AGGTGTCCATACCCACCTGCAGG + Intronic
1017294210 6:152775572-152775594 AAGTGTCATTCCCATCCTGCTGG + Intergenic
1018721026 6:166572796-166572818 ACGTGTCTCTACCCTCATGCAGG + Intronic
1019584374 7:1789517-1789539 ACGTCTCTTTACCATTCTGTTGG - Intergenic
1023174300 7:37420836-37420858 ACGTGACCTGTCCATCTTGCTGG + Intronic
1026306822 7:69149612-69149634 ACATGTTCTTACCTTTCTGCTGG - Intergenic
1032085452 7:128881184-128881206 CCGTGTCCCTACCACCCTGATGG + Intronic
1040897761 8:52386844-52386866 ACATTTTCTTACCATCCTGTAGG + Intronic
1049562320 8:143317893-143317915 ACATGTCCTTTCCTTCCCGCGGG - Intronic
1056810152 9:89757741-89757763 ACGTGGCCCTGCCATCCTCCTGG + Intergenic
1187153820 X:16705754-16705776 ACGTGTGCTTCCCAGCCTGTGGG + Intronic
1198608948 X:138375625-138375647 GCTTTTCCTTACCATCCTACAGG + Intergenic
1199540917 X:148957008-148957030 ACATGTTCTTCCCAGCCTGCTGG + Intronic