ID: 1132934586

View in Genome Browser
Species Human (GRCh38)
Location 16:2474226-2474248
Sequence GTCCCCGCCGGCAGCTCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132934574_1132934586 28 Left 1132934574 16:2474175-2474197 CCAAGGAGTCCTTGCTCGCGTCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG 0: 1
1: 0
2: 1
3: 15
4: 150
1132934575_1132934586 19 Left 1132934575 16:2474184-2474206 CCTTGCTCGCGTCGCGCGTGTCG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG 0: 1
1: 0
2: 1
3: 15
4: 150
1132934578_1132934586 -4 Left 1132934578 16:2474207-2474229 CCACCTGGGCCGCCGCCCCGTCC 0: 1
1: 2
2: 414
3: 3683
4: 3629
Right 1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG 0: 1
1: 0
2: 1
3: 15
4: 150
1132934579_1132934586 -7 Left 1132934579 16:2474210-2474232 CCTGGGCCGCCGCCCCGTCCCCG 0: 1
1: 0
2: 15
3: 185
4: 6788
Right 1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG 0: 1
1: 0
2: 1
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132934586 Original CRISPR GTCCCCGCCGGCAGCTCCCT CGG Intergenic
900923299 1:5687481-5687503 CGCCCCGGCAGCAGCTCCCTTGG - Intergenic
901028391 1:6291601-6291623 GTGCCTGCCAGTAGCTCCCTGGG + Intronic
901237750 1:7676533-7676555 GTCCAAGCCAGCCGCTCCCTAGG - Intronic
903628102 1:24745644-24745666 GTCCCGCCCGGCAGATCCCCCGG + Intronic
904611991 1:31731038-31731060 GTCCCCTCCGGCCGGGCCCTGGG + Exonic
905442754 1:38005462-38005484 AGCCTCGCCGGCAGCTCGCTCGG - Exonic
912502265 1:110130332-110130354 GCCACCTCCCGCAGCTCCCTGGG + Intergenic
912709847 1:111942495-111942517 GTCCCCACTGGCTGTTCCCTTGG - Intronic
913191741 1:116418746-116418768 GTCCCCGCCGGGAGCGCGCCCGG + Intergenic
915972932 1:160366904-160366926 GCCCCCGCCCCCAGCTCCCGAGG + Intergenic
917749017 1:178037836-178037858 AGCCCCGCCGGGAGCACCCTGGG + Intergenic
918114135 1:181482689-181482711 TTCCCCGCAGGCAGCGCCCTCGG - Intronic
920565254 1:206967866-206967888 GTCCCCTCTGGAAGCTCCCCAGG - Intronic
920912868 1:210233768-210233790 GTCCTCGCCGCCAGGTCCCACGG + Intronic
923672388 1:236051686-236051708 CTCCCACACGGCAGCTCCCTGGG - Intronic
1064408906 10:15088612-15088634 GTCACCGCCGACCGCTCCCAGGG + Intronic
1064478756 10:15719527-15719549 GTCCCCGCGCGCACCTCCCCGGG + Intronic
1067346952 10:45443972-45443994 TTCCCCGCGGCCAGCGCCCTTGG - Intronic
1070598761 10:77851135-77851157 ATCCCCTCGGGCAGCTTCCTGGG + Intronic
1071506237 10:86233526-86233548 ATCCCCTCCGGCAGCTCCCCTGG - Intronic
1074348919 10:112716017-112716039 CTCCCAGCTGGCAGGTCCCTGGG - Intronic
1074406417 10:113183703-113183725 CTCCCCGCCGGCATCTCTCATGG - Intergenic
1074852069 10:117447088-117447110 ATCCAAGCAGGCAGCTCCCTTGG - Intergenic
1075210385 10:120485920-120485942 GTCCCCACCGGCTGCTTACTAGG - Intronic
1076356087 10:129854878-129854900 GCCCCCGCGGGCAGCGCCCCTGG - Intronic
1076774687 10:132688167-132688189 GTCCCTGTCTGCAGCCCCCTGGG - Intronic
1081621658 11:44622423-44622445 GTGCCCACCCACAGCTCCCTGGG + Intergenic
1081774122 11:45665886-45665908 GGCCCGGCCAGCAGCGCCCTCGG - Intergenic
1089466676 11:118690258-118690280 GTCCCAGCCGGCAGGTCCCGCGG - Intergenic
1092330321 12:7581118-7581140 GTCCCATCCTGCAGCTACCTAGG - Intergenic
1092526384 12:9312562-9312584 TTCCCTGCCTGCAGCTCCCCCGG - Intergenic
1092540887 12:9419223-9419245 TTCCCTGCCTGCAGCTCCCCCGG + Intergenic
1101892554 12:108730710-108730732 GTCCCAGCCCTCTGCTCCCTTGG + Intronic
1102111810 12:110370902-110370924 GTCCCCGTGAGCAGCTCTCTGGG - Intergenic
1103925424 12:124421195-124421217 GTCCCCGCCGGCCTCTCCGTTGG + Intronic
1104765256 12:131326049-131326071 GTCCCCTCCTGCATCTCCCATGG + Intergenic
1104979431 12:132567176-132567198 GTCCACGCCAGCAGCAGCCTTGG + Intronic
1105405290 13:20128067-20128089 CTGACCGCCGCCAGCTCCCTCGG + Intergenic
1107559656 13:41547713-41547735 GTCCCAGCAGGCATCTCCTTAGG - Intergenic
1108131583 13:47307176-47307198 TTCCCAGCCTGCAGCTGCCTGGG - Intergenic
1113737891 13:112690724-112690746 CTTCCCGCCCGCAGCGCCCTGGG + Intronic
1113881674 13:113630425-113630447 GTCCCCGTCAGCTGCTCCCAGGG + Intronic
1114265738 14:21071548-21071570 GTCCCCGCCGGCAGGAGGCTGGG + Intronic
1114549762 14:23525951-23525973 GTCCCCTCCCCCACCTCCCTTGG - Exonic
1115235841 14:31207819-31207841 GACCCCGCCGGCGGCCACCTGGG + Intergenic
1115752121 14:36504209-36504231 GTCCCCGCGGGCAGCTCAGCGGG + Intronic
1121210912 14:92207451-92207473 CTCCCCGCTGGCAGATCCCAGGG + Intergenic
1121734168 14:96206280-96206302 GTCCCCACAGGCAGCACCCCAGG + Intronic
1122979308 14:105184546-105184568 GGCCCTGGGGGCAGCTCCCTTGG + Intergenic
1128326833 15:66729430-66729452 GACCCGGCCGGCTGCTCCCGGGG - Intronic
1130108873 15:80949011-80949033 GCCCCTGCCAGCAGCTGCCTGGG + Exonic
1131367817 15:91854241-91854263 GCCCCGGCCGGCAGCTCCCCCGG - Intronic
1132600495 16:770659-770681 GTCCCCCCAGGCGGCTCCCCTGG - Exonic
1132600537 16:770751-770773 GTCCCCCCAGGCAGCTTCCCTGG - Intronic
1132934586 16:2474226-2474248 GTCCCCGCCGGCAGCTCCCTCGG + Intergenic
1136632861 16:31499284-31499306 GCCCCCACAGGCAGCTACCTTGG + Exonic
1139664941 16:68448634-68448656 GGCCCCGCCCGCAGGTTCCTGGG + Exonic
1141424296 16:83935389-83935411 GTCCCCGTCTCCATCTCCCTGGG - Intronic
1143017057 17:3896477-3896499 GTCCCCACCGGCAGATCCAGAGG + Intergenic
1143669293 17:8385364-8385386 GGCACCTTCGGCAGCTCCCTAGG - Intergenic
1144269124 17:13600885-13600907 GGCCACACCGCCAGCTCCCTCGG + Exonic
1144955686 17:19017792-19017814 GTGCCCTCCAGCATCTCCCTGGG - Intronic
1147179242 17:38674296-38674318 GACCGCGCCGCCAGCTCCCCAGG + Exonic
1148818371 17:50346451-50346473 GCCCCCGCGCGCAGCTCCCTAGG - Intronic
1149995928 17:61405879-61405901 GGCCTCGCCGCCAGCTCCCTGGG - Intronic
1151597597 17:75087901-75087923 GTCCCCGCCCACACCGCCCTGGG + Intronic
1153786960 18:8543807-8543829 GTCCCTGCCAGCATCGCCCTTGG - Intergenic
1154241392 18:12657387-12657409 GTCCCCGCCGGATCCTCCCGGGG + Intronic
1154374692 18:13799288-13799310 GTCCCCGAAGGCAGCTCCCTGGG - Intergenic
1156448563 18:37253983-37254005 CTCCCCGCCGGCAGCGCCCCGGG - Intronic
1160539278 18:79611583-79611605 GTCCCCTTTGGCAGCTCCCATGG + Intergenic
1160839727 19:1140716-1140738 ATGCCCGCAGGCAGCTCCCACGG + Intronic
1161959523 19:7516142-7516164 AGCCCCGCCGGCGGCCCCCTCGG - Exonic
1162931438 19:13959707-13959729 CTGCCCCCCGGCAGCTCCCCGGG - Intronic
1164977127 19:32581509-32581531 GCCCCCGCCGCCAGCCTCCTGGG - Intronic
1165486663 19:36100758-36100780 GTGCCCGCGGCCAGCTTCCTGGG - Exonic
1167232994 19:48297157-48297179 GTCAGCGCCAGCAGCTACCTGGG - Exonic
926724220 2:15984725-15984747 GTCCCGGCCGGCTGCTGCCCTGG + Intergenic
932576116 2:72963310-72963332 GTCCCCACCAGCAGGTCCCAAGG - Intronic
934818781 2:97353941-97353963 CTCCCCGCCAGCAGGTTCCTTGG - Intergenic
934860377 2:97759521-97759543 GGCCCCGCAGGAAGCTCCCTGGG - Intronic
935305094 2:101729974-101729996 GTCTCCTCCCGCAGCTCCGTGGG + Intronic
937310150 2:120897076-120897098 GTGCCCGCAGGCAGCCCCATGGG - Intronic
940748532 2:157597507-157597529 GGCCCCGACGACAGCTCCCGCGG + Intronic
940841244 2:158584095-158584117 GTCCCCGCCAGCAGGCCACTTGG - Intronic
942277875 2:174335996-174336018 GTCCCCTGCGGCTGCTCCCGGGG - Intronic
943651064 2:190458043-190458065 GACACCGCTGGCAGCTTCCTCGG - Intronic
944273135 2:197805104-197805126 CTCCCTGCCGGCCGCGCCCTCGG - Exonic
947877028 2:233474347-233474369 GTCTCCGCAGGCACCTCCCCAGG - Intergenic
1169400257 20:5273727-5273749 GTCTCCACTGGCAGCTTCCTGGG + Intergenic
1170026223 20:11891456-11891478 GTCCCCGCCGGCAGCGCCTCAGG - Intronic
1172641537 20:36443155-36443177 GTCCCAGCCCCCAGATCCCTTGG + Intronic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1173166601 20:40690453-40690475 GTGCCCGTCGGCTGCTCCCTGGG + Intergenic
1173464700 20:43271638-43271660 GTCCCAGCCACCAGCTCTCTGGG - Intergenic
1173475364 20:43355337-43355359 GTCCCAGCAGGCACCTCCTTGGG - Intergenic
1173499888 20:43545480-43545502 ATCCCAGGAGGCAGCTCCCTTGG - Intronic
1174038394 20:47682400-47682422 GTTCCCGGCAGCAGCTTCCTTGG - Intronic
1174883618 20:54307518-54307540 GTCCCTGCCTGCAGCACCCAGGG + Intergenic
1175771919 20:61629323-61629345 CTCCCTGCCGGCTGCTCCCAGGG - Intronic
1175823346 20:61923727-61923749 GTCCCTGCCTGCAGCTTCCCAGG + Intronic
1175847639 20:62066642-62066664 GTCCCCGCACCCAGCTGCCTTGG + Intergenic
1179217499 21:39380338-39380360 GTCCGCTACGGCAGCTCCATGGG - Exonic
1182519039 22:30874996-30875018 GTCCCCGACAGTAGCTCCGTGGG + Intronic
1183301121 22:37059646-37059668 GTCCACGCCGGCTGCACCCTGGG - Intronic
1183444504 22:37844218-37844240 GTCCCCGGCGGCGGCTGCCATGG + Exonic
1183780366 22:39995274-39995296 GTCCCCGCCGCCAACGCCCGGGG + Exonic
1184733212 22:46382236-46382258 GTCCCCGCCTTCAGTTCCTTGGG - Intronic
1185365581 22:50435131-50435153 GTCTCAGGCGGCAGCTCCTTCGG - Intronic
950683944 3:14603085-14603107 GTCCATGCCCGCGGCTCCCTGGG - Intergenic
960994741 3:123333423-123333445 GGCCCGGCCTGGAGCTCCCTGGG + Intronic
962809169 3:138946903-138946925 ACTCCCGCCGGCCGCTCCCTAGG - Exonic
966886632 3:184380682-184380704 GTCCCCGCAGGCTGCACCTTCGG + Exonic
966984189 3:185164713-185164735 CTCCCCGATAGCAGCTCCCTGGG - Intergenic
967534489 3:190586715-190586737 GTCCTCGAAGGCAGCTCCCTGGG - Intronic
968845782 4:3040942-3040964 GCCCCCGCTGGCCTCTCCCTGGG - Intergenic
968871311 4:3244103-3244125 GTCCCTGCTGGCAGCTGCCTGGG - Intergenic
968878556 4:3286922-3286944 GCCCAGGCCGGGAGCTCCCTCGG + Intergenic
968901672 4:3435052-3435074 GTCCCCTGGGGCAGCTCACTGGG + Intronic
977400115 4:96521408-96521430 GTCCCCGCCGTGGGCTCCCGTGG + Intergenic
978174034 4:105708429-105708451 GTCCCGGCCCGCAACTCCCTCGG + Intronic
984879641 4:184399253-184399275 GTGCTGGCCGGCTGCTCCCTGGG - Intronic
985784435 5:1886616-1886638 GCCCCCGCCGCTTGCTCCCTGGG + Intronic
990954548 5:61330408-61330430 GTCCCAGGCTGCAGGTCCCTGGG - Intergenic
990980454 5:61598251-61598273 GTCCCCTCCTGCACTTCCCTAGG - Intergenic
992106301 5:73451500-73451522 GCCCGGGCCGGCAACTCCCTGGG + Intergenic
992286097 5:75236960-75236982 GGCCCCGCCCCCAGCTCCCGTGG + Intergenic
997627102 5:135338561-135338583 GTCACGGCCAGCAGCTCTCTGGG - Intronic
999400152 5:151258210-151258232 CTTCCTGCCGGCAGCTCCATGGG - Intronic
1001035253 5:168292328-168292350 GTCCCGGCCGGCGGCTCCAGGGG - Intronic
1002280072 5:178124659-178124681 ATCCCTTCCAGCAGCTCCCTGGG + Exonic
1002780293 6:359851-359873 GTCCCTGCTGGCAGCGCCCATGG - Intergenic
1017719760 6:157236236-157236258 GTCCCTGCCGCCAGCTCCGCCGG - Intergenic
1017913952 6:158818390-158818412 GTGCCCGCCGGCTGCCCCTTGGG - Intronic
1019305677 7:333187-333209 CCCCCCGCCGGCCCCTCCCTGGG - Intergenic
1019407526 7:891530-891552 GTCCCTCCCGCCAGCTCGCTGGG + Intronic
1019455324 7:1123812-1123834 GCTCCCTCCGCCAGCTCCCTCGG + Intronic
1019601684 7:1886856-1886878 GCCCAGGCCAGCAGCTCCCTGGG + Intronic
1019610121 7:1932271-1932293 GCCCCTGCCGGCTGCTCCCCAGG + Intronic
1019748377 7:2713308-2713330 GTCCCAGCCAGCCGCTCCCAGGG + Exonic
1022746846 7:33181179-33181201 GTCCACTCTGGCAGCTCCCCTGG - Intronic
1026796291 7:73368069-73368091 GTGCCCCCCGGCACTTCCCTGGG - Intergenic
1029123267 7:98281956-98281978 TTCCCCGCCGGCGGCTTCCGAGG + Intronic
1029654177 7:101913510-101913532 GTCCCCACCTGCCCCTCCCTGGG - Intronic
1035116090 7:156525143-156525165 GACTCCGCCGTCAGCTCCTTAGG + Intergenic
1042252965 8:66775063-66775085 CACCCCACCGGCAGCTCCTTCGG + Intronic
1042533124 8:69834411-69834433 GGCCGCTCCGGCATCTCCCTCGG + Intronic
1043401897 8:79892045-79892067 GTCCCCTCCCGCGGCTCCCGCGG + Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1048852967 8:138662030-138662052 GTCCCGGCCGGCTGGGCCCTGGG + Exonic
1048999729 8:139817102-139817124 GGCCCAGCCTGCAGCACCCTGGG - Intronic
1049218296 8:141417683-141417705 GTCCCGGGCGGCAGCGCCCCCGG + Intronic
1049421660 8:142519290-142519312 GTCCCTGCCGGCAGCTCATAGGG - Intronic
1049638909 8:143705530-143705552 GTCCCCCCCAGCACCTCCCGGGG - Intronic
1050227672 9:3478977-3478999 GTCCCAACTTGCAGCTCCCTGGG - Intronic
1051418939 9:16871301-16871323 CTCCACGCCCGCAGCTCCCCGGG - Intergenic
1057208190 9:93185356-93185378 GTCGCCGCCGCCTCCTCCCTGGG - Exonic
1059972553 9:119682489-119682511 CTCCCCACCTGCAGGTCCCTAGG - Intergenic
1060818419 9:126647946-126647968 GGCACAGACGGCAGCTCCCTGGG - Intronic
1061406325 9:130394731-130394753 GACCCTGCTGGCAGCTCCCAAGG - Intronic
1062346714 9:136118466-136118488 GTCCCCGACCGCAGCTCACCCGG + Exonic
1062689352 9:137833474-137833496 GTCCCGGCCGGCAGCTAGCAAGG - Intronic
1189002874 X:36963968-36963990 GCCCCCGCCCGCGGCTCCCGCGG + Intergenic
1189082663 X:37991389-37991411 TTCCCCGCCTTCAGCTCTCTGGG - Intronic
1191890212 X:65931961-65931983 GTCCTCTCTGGCTGCTCCCTCGG + Intergenic
1197177744 X:123503138-123503160 GTACCTGCCGGCAGTTCCTTTGG - Intergenic
1199628817 X:149762208-149762230 GTCCCCTCCGACACCCCCCTCGG - Intergenic