ID: 1132934914

View in Genome Browser
Species Human (GRCh38)
Location 16:2475279-2475301
Sequence CTCGAATGGGGCCCGCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132934914_1132934923 1 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934923 16:2475303-2475325 CGGGGATCCCCGGCCACGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1132934914_1132934933 22 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934933 16:2475324-2475346 GGGTTGGGGGCTCCAGAGCCCGG 0: 1
1: 0
2: 2
3: 52
4: 490
1132934914_1132934925 6 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934925 16:2475308-2475330 ATCCCCGGCCACGCGCGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1132934914_1132934928 8 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934928 16:2475310-2475332 CCCCGGCCACGCGCGGGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 98
1132934914_1132934924 2 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1132934914_1132934926 7 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934926 16:2475309-2475331 TCCCCGGCCACGCGCGGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1132934914_1132934930 9 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934930 16:2475311-2475333 CCCGGCCACGCGCGGGTTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 81
1132934914_1132934922 -9 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934922 16:2475293-2475315 CCATTCGAGGCGGGGATCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132934914 Original CRISPR CTCGAATGGGGCCCGCAGCC CGG (reversed) Intronic