ID: 1132934919

View in Genome Browser
Species Human (GRCh38)
Location 16:2475291-2475313
Sequence GGGGATCCCCGCCTCGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132934919_1132934933 10 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934933 16:2475324-2475346 GGGTTGGGGGCTCCAGAGCCCGG 0: 1
1: 0
2: 2
3: 52
4: 490
1132934919_1132934925 -6 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934925 16:2475308-2475330 ATCCCCGGCCACGCGCGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1132934919_1132934934 20 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934934 16:2475334-2475356 CTCCAGAGCCCGGCACCGCCCGG 0: 1
1: 0
2: 1
3: 23
4: 233
1132934919_1132934928 -4 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934928 16:2475310-2475332 CCCCGGCCACGCGCGGGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 98
1132934919_1132934926 -5 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934926 16:2475309-2475331 TCCCCGGCCACGCGCGGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1132934919_1132934924 -10 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1132934919_1132934930 -3 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934930 16:2475311-2475333 CCCGGCCACGCGCGGGTTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132934919 Original CRISPR GGGGATCCCCGCCTCGAATG GGG (reversed) Intronic