ID: 1132934923 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:2475303-2475325 |
| Sequence | CGGGGATCCCCGGCCACGCG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 92 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 88} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132934914_1132934923 | 1 | Left | 1132934914 | 16:2475279-2475301 | CCGGGCTGCGGGCCCCATTCGAG | 0: 1 1: 0 2: 0 3: 7 4: 80 |
||
| Right | 1132934923 | 16:2475303-2475325 | CGGGGATCCCCGGCCACGCGCGG | 0: 1 1: 0 2: 0 3: 3 4: 88 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132934923 | Original CRISPR | CGGGGATCCCCGGCCACGCG CGG | Intronic | ||