ID: 1132934924

View in Genome Browser
Species Human (GRCh38)
Location 16:2475304-2475326
Sequence GGGGATCCCCGGCCACGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132934919_1132934924 -10 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1132934914_1132934924 2 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132934924 Original CRISPR GGGGATCCCCGGCCACGCGC GGG Intronic
900072106 1:779118-779140 GGGGATCCCCGGGCCCTGGCTGG - Intergenic
900292294 1:1928682-1928704 GGGGGGCTCCGGCCACGTGCCGG - Intronic
905630321 1:39514823-39514845 AGGTCTCCCCGGCCAGGCGCAGG - Intronic
905667439 1:39771366-39771388 AGGTCTCCCCGGCCAGGCGCAGG + Intronic
915322693 1:155064244-155064266 GGCGATCCCCAGCCTCCCGCAGG + Intronic
915345540 1:155195169-155195191 CGGGATCCCGGGCCCCGGGCGGG + Intergenic
916179288 1:162070030-162070052 GGGGAGCCCTGGCCGCGCGGCGG - Exonic
920674607 1:208030403-208030425 GAGCATCCCCGGCCCAGCGCTGG - Intronic
922267042 1:223993073-223993095 GGGGATCCCCGGGCCCTGGCTGG - Intergenic
924834970 1:247638875-247638897 GGGGATCCCCCGCTATGGGCTGG - Intergenic
1070140168 10:73732874-73732896 GGGGCTCCCCGCCCGCGCTCAGG - Intergenic
1077250157 11:1557321-1557343 GGGGCTCCCCGCCCGCGCTCAGG + Exonic
1080551455 11:33376548-33376570 GGGCATCGCCGGCCACGGCCCGG - Intergenic
1081812520 11:45922037-45922059 GGGGATCCCCGGCCCTGCCCAGG + Intronic
1084019477 11:66409224-66409246 GGGACTCCCCGGCCCGGCGCGGG - Intergenic
1084677500 11:70644540-70644562 GGGGGCCCCCGGCCAAGGGCAGG + Intronic
1085396874 11:76210839-76210861 GGGTGGCCCCGGCCGCGCGCGGG + Intergenic
1100347001 12:93742368-93742390 GCGGGTGCCCGGCCAAGCGCTGG - Intronic
1100423418 12:94459839-94459861 GAGGATCCCGGTCCACGCGGAGG - Exonic
1102651778 12:114447550-114447572 GGTGAGCCCAGGCCAAGCGCTGG + Intergenic
1102997881 12:117363435-117363457 GGGGATGCACGGCCACGAGATGG + Intronic
1108915589 13:55606424-55606446 TGGAATCCCCGTGCACGCGCGGG + Intergenic
1112290737 13:98142888-98142910 GCAGATCCCCGGCGGCGCGCTGG + Intronic
1113082875 13:106535731-106535753 GCGGCTCCGCGGCCGCGCGCTGG + Intergenic
1113695524 13:112343054-112343076 GGGGATCACCGGCCACACCCCGG + Intergenic
1113894275 13:113753735-113753757 GGCGCTCCCCTGCCACGCCCGGG - Intergenic
1115754804 14:36519988-36520010 GGGGTTCCCCGGGCACGGACAGG + Intronic
1119014081 14:71031318-71031340 GGGGACCCCAGGCCAAGTGCTGG + Intronic
1122129685 14:99597820-99597842 GGAGATCCCCTGACACACGCTGG - Intronic
1123060494 14:105592196-105592218 GAGGGTCCCCGACCACCCGCAGG + Intergenic
1123084972 14:105713167-105713189 GAGGGTCCCCGACCACCCGCAGG + Intergenic
1132519694 16:381580-381602 GGGGACCCCCAACCCCGCGCCGG + Intronic
1132689097 16:1174560-1174582 GGGAAGCCCCTGCCACGCTCAGG + Intronic
1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG + Intronic
1132987855 16:2777302-2777324 GGGCATGCTGGGCCACGCGCGGG - Intergenic
1134644925 16:15858260-15858282 GCGGGTCCCCGGCCTGGCGCGGG - Intergenic
1139728836 16:68924918-68924940 TGGGATCCCTGGCCTCGGGCTGG - Intronic
1140454388 16:75096366-75096388 GGGCATCCCCAGGCACGCCCAGG + Intronic
1141626528 16:85264367-85264389 GGGGAGCCCTGGCCTCACGCTGG + Intergenic
1145988098 17:29061066-29061088 GGGGATGCCTGGCCACGCTCAGG - Intergenic
1145991246 17:29080640-29080662 GGGCCTCCTCGGCCACGCGGCGG - Intronic
1148652551 17:49260344-49260366 GCGGAGCCCCGGCCTCGCACGGG + Intergenic
1149296314 17:55265220-55265242 CGGGCTCCCCGGCGACGTGCAGG - Exonic
1152938358 17:83153223-83153245 GGGGATGCCTGGCCACGGACGGG - Intergenic
1154338685 18:13485595-13485617 GGTGATCCCAGGCCACGCCCCGG - Intronic
1160165553 18:76508015-76508037 GAGGCTCCCCCGCCACGAGCAGG + Intergenic
1160738725 19:676368-676390 AGGGAGCGCCGGCCGCGCGCTGG + Exonic
1161400778 19:4065652-4065674 GGGGATGCGCGGCCTAGCGCAGG - Intronic
1162393941 19:10405233-10405255 GGGGATTCCCGGATAGGCGCGGG + Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
927710935 2:25325524-25325546 GGGGAAACAGGGCCACGCGCAGG - Intronic
929501317 2:42493716-42493738 AGGACTCCCCGGCCACCCGCAGG - Exonic
929762488 2:44817476-44817498 GGGCATCCCAGGCCAAGCGCAGG - Intergenic
934539160 2:95159897-95159919 CGTGCTCGCCGGCCACGCGCCGG + Intronic
945381332 2:209145249-209145271 GGGGAGCCCAGCCCACGCCCAGG + Intergenic
1169093269 20:2873946-2873968 GGGGGTCCCCGGAAACGTGCCGG + Intronic
1169902803 20:10570414-10570436 GGGGATCACCGGGCACAGGCTGG + Intronic
1171517307 20:25747708-25747730 GGGGATCCCTGGGCAGGCACTGG + Intergenic
1172100633 20:32482772-32482794 GGGGTTCCCCGGCGCGGCGCGGG - Intronic
1172149740 20:32781249-32781271 GGAGATCCCAGGCCACGCCACGG + Intronic
1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG + Intronic
1181433800 22:22898879-22898901 GGGGATCCCAGGCCTGGGGCAGG - Intergenic
1181434742 22:22904248-22904270 GGGGATCCCAGGCCTGGGGCAGG - Intergenic
1182698352 22:32211555-32211577 GGGGATCCCAGGCCTGGGGCAGG - Intergenic
1184784578 22:46665500-46665522 GGGGAGACCAGGCCACCCGCTGG - Intronic
1185277206 22:49954968-49954990 GGGGACCCCCGGCCTGGCTCTGG + Intergenic
954109034 3:48424119-48424141 GGGGCTCCCCTGCCAAGCCCTGG + Exonic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
968693290 4:2008135-2008157 CGGGATCCCCGCCCTCGCCCAGG + Intronic
981074700 4:140579364-140579386 GGGGCTCCCCGGACCTGCGCTGG + Intergenic
984701164 4:182819610-182819632 GAGGCTCCCCGGCCTCCCGCAGG + Intergenic
984876401 4:184371683-184371705 CGGCATCCCTGGCCAGGCGCAGG + Intergenic
985445883 4:190021203-190021225 GGGGATCCCAGGGCCCGCCCAGG - Intergenic
1002314905 5:178337285-178337307 GGTGATCCCCGGCCAGACCCCGG + Intronic
1003218496 6:4135967-4135989 GGTGATACCCGGCCTCGCTCCGG - Intergenic
1006164465 6:32056455-32056477 GGGGAGCCCCAGCCACAAGCAGG + Intronic
1006806617 6:36793320-36793342 GGGCATCCCCTGCCACGGACAGG + Intronic
1018768885 6:166955760-166955782 GGGGAGCCCTGGGCACGCTCTGG - Intronic
1018960198 6:168441994-168442016 GCGGATCCCGGGCCTCTCGCCGG + Intronic
1022427692 7:30284645-30284667 GAGGTTCCCCGGCCCCGCGCCGG - Exonic
1026787862 7:73313151-73313173 GGGGGTGGCCGGCCACGGGCAGG + Exonic
1032014538 7:128369605-128369627 GGTGATCCCCGCCCCCGCTCCGG - Intergenic
1040073325 8:43205427-43205449 GGGGAACCCTGGCCATTCGCGGG + Intergenic
1048669052 8:136695895-136695917 GGGGACCCCAGGCCAGGCCCAGG - Intergenic
1049440919 8:142609369-142609391 GGGGATCCCGGGCCAAGCTGCGG - Intergenic
1057716848 9:97502145-97502167 GGGGCGCCCCCGCCACCCGCAGG + Intronic
1061514918 9:131083477-131083499 GGAGACCCCCGGCCACACCCTGG - Intronic
1062656305 9:137605872-137605894 CGGGAGCCCTGGCCCCGCGCAGG - Intronic
1187273790 X:17801476-17801498 GAGGATCCCCAGCCAGCCGCAGG - Exonic
1188004578 X:25008214-25008236 AGGGATCCCCTGCCAAGAGCAGG - Intronic
1197533905 X:127663805-127663827 GGGGAACCCCTTCCACGCACTGG - Intergenic
1200117898 X:153777149-153777171 GGGCATCCCAGGCCAGGGGCAGG + Intronic