ID: 1132934925

View in Genome Browser
Species Human (GRCh38)
Location 16:2475308-2475330
Sequence ATCCCCGGCCACGCGCGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132934919_1132934925 -6 Left 1132934919 16:2475291-2475313 CCCCATTCGAGGCGGGGATCCCC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1132934925 16:2475308-2475330 ATCCCCGGCCACGCGCGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1132934920_1132934925 -7 Left 1132934920 16:2475292-2475314 CCCATTCGAGGCGGGGATCCCCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132934925 16:2475308-2475330 ATCCCCGGCCACGCGCGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1132934921_1132934925 -8 Left 1132934921 16:2475293-2475315 CCATTCGAGGCGGGGATCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1132934925 16:2475308-2475330 ATCCCCGGCCACGCGCGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1132934914_1132934925 6 Left 1132934914 16:2475279-2475301 CCGGGCTGCGGGCCCCATTCGAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1132934925 16:2475308-2475330 ATCCCCGGCCACGCGCGGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132934925 Original CRISPR ATCCCCGGCCACGCGCGGGT TGG Intronic