ID: 1132934947

View in Genome Browser
Species Human (GRCh38)
Location 16:2475366-2475388
Sequence TGCGGCTTGGCCTACGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132934936_1132934947 1 Left 1132934936 16:2475342-2475364 CCCGGCACCGCCCGGCGCTGCAG 0: 1
1: 0
2: 2
3: 26
4: 256
Right 1132934947 16:2475366-2475388 TGCGGCTTGGCCTACGGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1132934940_1132934947 -9 Left 1132934940 16:2475352-2475374 CCCGGCGCTGCAGCTGCGGCTTG 0: 1
1: 0
2: 3
3: 57
4: 383
Right 1132934947 16:2475366-2475388 TGCGGCTTGGCCTACGGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1132934941_1132934947 -10 Left 1132934941 16:2475353-2475375 CCGGCGCTGCAGCTGCGGCTTGG 0: 1
1: 0
2: 0
3: 33
4: 279
Right 1132934947 16:2475366-2475388 TGCGGCTTGGCCTACGGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1132934939_1132934947 -6 Left 1132934939 16:2475349-2475371 CCGCCCGGCGCTGCAGCTGCGGC 0: 1
1: 0
2: 5
3: 50
4: 390
Right 1132934947 16:2475366-2475388 TGCGGCTTGGCCTACGGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1132934932_1132934947 27 Left 1132934932 16:2475316-2475338 CCACGCGCGGGTTGGGGGCTCCA 0: 1
1: 1
2: 0
3: 3
4: 85
Right 1132934947 16:2475366-2475388 TGCGGCTTGGCCTACGGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1132934935_1132934947 7 Left 1132934935 16:2475336-2475358 CCAGAGCCCGGCACCGCCCGGCG 0: 1
1: 0
2: 1
3: 35
4: 307
Right 1132934947 16:2475366-2475388 TGCGGCTTGGCCTACGGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1132934937_1132934947 0 Left 1132934937 16:2475343-2475365 CCGGCACCGCCCGGCGCTGCAGC 0: 1
1: 0
2: 2
3: 41
4: 340
Right 1132934947 16:2475366-2475388 TGCGGCTTGGCCTACGGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132934947 Original CRISPR TGCGGCTTGGCCTACGGGAG GGG Intronic