ID: 1132935479

View in Genome Browser
Species Human (GRCh38)
Location 16:2478408-2478430
Sequence CACCCCATGCAGAGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132935472_1132935479 26 Left 1132935472 16:2478359-2478381 CCAGGGAGGAAGGAGGGGATGTT 0: 1
1: 0
2: 4
3: 46
4: 403
Right 1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 181
1132935475_1132935479 3 Left 1132935475 16:2478382-2478404 CCAGTATTGAGCAGCGGGCAGTG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132935479 Original CRISPR CACCCCATGCAGAGTGTGGA GGG Intronic
900097288 1:945112-945134 CACCCCATGCCGAGTGCTCAGGG + Exonic
900101865 1:965412-965434 CCCCCCATGCAGGCAGTGGAGGG - Exonic
900511466 1:3062968-3062990 CAAATCCTGCAGAGTGTGGAGGG - Intergenic
900864797 1:5260593-5260615 CCCTCCATGGAGTGTGTGGAAGG + Intergenic
901092254 1:6649651-6649673 CAACCCCTGCAGAGCGTGGCAGG + Intronic
902886718 1:19410463-19410485 CACACAATGCAAAGTGTGTATGG + Intronic
903670206 1:25031017-25031039 CACCCCATTCACGGTTTGGAGGG + Intergenic
906932156 1:50180623-50180645 CTTCCAATGCATAGTGTGGATGG + Intronic
907304201 1:53504853-53504875 CACCCCACGCCGAGTGAGGGAGG + Intergenic
910169843 1:84366274-84366296 GACCCCAGGCAGAGAGAGGAGGG - Intronic
911086837 1:93985668-93985690 GACCCCAGGCAGGGTGAGGAGGG + Intergenic
916979155 1:170114957-170114979 CACCGAAGGCAGAGTCTGGATGG + Intergenic
917982373 1:180278446-180278468 CCTACCAAGCAGAGTGTGGATGG - Exonic
921424030 1:214982044-214982066 CACACCATGGAGAGTGTCCAGGG - Intergenic
921763821 1:218947263-218947285 CAGCCCATCCAGATTTTGGATGG + Intergenic
1063401291 10:5748607-5748629 CACATCTTGCAGCGTGTGGATGG - Exonic
1064831758 10:19476411-19476433 CACCCCTTGCCAAGTGAGGAAGG - Intronic
1068068908 10:52170563-52170585 CAGCTCTTGCAGAGTGTCGATGG - Intronic
1069905281 10:71728620-71728642 CACCACATGCAAAGTCTGTATGG + Intronic
1071366279 10:84903667-84903689 CACCACTTGCAGAGAGTTGATGG - Intergenic
1071565689 10:86670274-86670296 CACCTCATGCAAAGTGTGCAAGG - Intronic
1075557468 10:123444020-123444042 CACCCCAAGAAGAGTGTGGCAGG - Intergenic
1075655251 10:124156833-124156855 GACCCCAGGAAGAGTGTGGCTGG - Intergenic
1075993138 10:126854844-126854866 CACCCCATGCAAAATGGGAAAGG - Intergenic
1076693263 10:132234561-132234583 CACAGGATGCAGGGTGTGGAGGG - Intronic
1077184410 11:1229869-1229891 CACCCCAGGCAGAGGCTGGCGGG - Intronic
1079174388 11:18125340-18125362 CACCCAAAGCAGTGTGTAGAGGG - Intronic
1079315922 11:19407752-19407774 CACAAAATGCCGAGTGTGGAAGG - Intronic
1079380253 11:19931863-19931885 CACCCCATGCCCAGTGTGCACGG - Intronic
1080736598 11:35022111-35022133 CAGCCCATGGAGAGTGAGGAGGG + Intergenic
1081730306 11:45367414-45367436 AACCCCTTGCATTGTGTGGACGG - Intergenic
1084266528 11:68008136-68008158 CACCCAACCCAGAGTGGGGAGGG + Intergenic
1086948371 11:92866729-92866751 TTCCCCACGCAGATTGTGGATGG + Exonic
1088617123 11:111642124-111642146 CACCAAATGCGGAGGGTGGAGGG + Intronic
1088791582 11:113231633-113231655 CACCCCCGGCAGACTCTGGATGG + Exonic
1089613982 11:119684959-119684981 CTCCCCATCCTGAGTGTAGAGGG - Intronic
1089864306 11:121618300-121618322 CACCCCAGGAAGTATGTGGAGGG - Intronic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096503029 12:52076881-52076903 CATCCCATGGGAAGTGTGGACGG + Exonic
1098385734 12:69916692-69916714 GACTCCATCCAGATTGTGGAGGG - Intronic
1099569927 12:84304520-84304542 TAGCCCATGCAGGGTGTGGGTGG - Intergenic
1101375985 12:104172140-104172162 AACCCCTTGCAGAGTAAGGAAGG + Intergenic
1101397586 12:104362221-104362243 CCCCCCATGCAGCATGGGGAGGG + Intergenic
1102625644 12:114233279-114233301 CACACCATCCTGAGTTTGGAAGG - Intergenic
1104505286 12:129326144-129326166 CACCCCATGGAGAGTGTCCACGG - Intronic
1105323124 13:19346238-19346260 CACCGCATGCAGGCTGTGGCCGG + Intergenic
1111897611 13:94160538-94160560 CAACCCATGCAGTGCATGGAAGG - Intronic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1119941893 14:78649891-78649913 CATGCCATGCAGAGTTTGTATGG - Intronic
1120928913 14:89827520-89827542 CCCACCATGCAGAGTATAGAAGG + Intronic
1122091794 14:99345803-99345825 AACCCCATGCAGAAGGAGGAGGG + Intergenic
1122951389 14:105047080-105047102 CATGCCAGGCAGAGTGGGGATGG + Intergenic
1124028535 15:25989079-25989101 GGCCCCAAGCATAGTGTGGAAGG - Intergenic
1126432285 15:48598781-48598803 CTCCCACTGCAGTGTGTGGATGG + Intronic
1128328906 15:66742959-66742981 CACCACATGCTAACTGTGGAAGG - Intronic
1129053893 15:72806183-72806205 GACCCCTGGCAGAGTGTGAATGG - Intergenic
1129411317 15:75352058-75352080 CATCCCATGGAGGGTGGGGATGG + Intronic
1129513849 15:76144514-76144536 GGCTCCATGCAGAGTGAGGAAGG + Intronic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1130097952 15:80870223-80870245 CACCTCATGCAGGGTGGGTAGGG + Intronic
1131194408 15:90343839-90343861 CACCCCATGCATAGTTCAGATGG - Intergenic
1132284507 15:100652235-100652257 CACCCCGTGCAGAGATGGGATGG + Intergenic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1134066716 16:11233114-11233136 CCCCCCATGAAGAGGGAGGAGGG - Intergenic
1134248543 16:12558076-12558098 CATCCCATGCAAAGTGGGGACGG + Intronic
1137584382 16:49655505-49655527 GACCCCATGCTGATTGTGCAGGG - Intronic
1137705808 16:50535066-50535088 CACCCCAACCACAGTCTGGATGG - Intergenic
1139691050 16:68642397-68642419 CTTGCCATCCAGAGTGTGGAGGG - Intronic
1140038516 16:71389854-71389876 CCCCCCATGTAAAGTGGGGACGG + Exonic
1140236663 16:73165422-73165444 GGGCCCAGGCAGAGTGTGGATGG - Intergenic
1142852265 17:2709966-2709988 CACCCCCAGCAGAGTTAGGAAGG + Intronic
1143671382 17:8398162-8398184 CACACCATGCACAGGGTGAAGGG + Intergenic
1144209600 17:13003227-13003249 GACACCCTGAAGAGTGTGGAGGG + Intronic
1145254562 17:21315569-21315591 CAGCCCAGGCAAAGTGTGCAGGG - Intergenic
1145322034 17:21772395-21772417 CAGCCCAGGCAAAGTGTGCAGGG + Intergenic
1151878570 17:76881092-76881114 CACCCTATGGACTGTGTGGAGGG + Intronic
1152373432 17:79904904-79904926 AACCCCATGAACAGTGTGTACGG + Intergenic
1152373662 17:79906338-79906360 AACCCCATGAACAGTGTGTATGG - Intergenic
1154376741 18:13817128-13817150 CACTCCACCCAGAGTGGGGAGGG - Intergenic
1155431948 18:25768782-25768804 GACCCCATGCAGAGTTTCCAAGG - Intergenic
1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG + Intronic
1160309646 18:77777614-77777636 CACCCCATGAAAAATGGGGAAGG + Intergenic
1161063080 19:2224944-2224966 GACCCCATGCAGTGTGTGGTTGG + Intronic
1161377864 19:3949461-3949483 CAGCCCATGGAGTCTGTGGAGGG + Intergenic
1161605302 19:5211629-5211651 CAACCCATCCGGGGTGTGGAGGG - Exonic
1163321952 19:16579966-16579988 CATCCCTTCCAGAGTGGGGAAGG + Intronic
1165115306 19:33524754-33524776 CTCCCCAGGGACAGTGTGGAGGG - Intergenic
1165834456 19:38745634-38745656 CACGCCACTCAGAGTCTGGATGG + Intronic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1166740676 19:45113080-45113102 CACCCCTTCCATAGTGTGCAGGG + Intronic
925217845 2:2112496-2112518 CACACGATGCAGTGTGTGGTGGG + Intronic
925320242 2:2960647-2960669 CACTGCTTGCTGAGTGTGGATGG + Intergenic
925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG + Intronic
925367900 2:3323698-3323720 CACCCAGAGCAGAGTCTGGATGG + Intronic
925901317 2:8511240-8511262 AACTCCATGCAGAGAGTGGCTGG + Intergenic
932070115 2:68611736-68611758 CACTCATTGCAGAGAGTGGAGGG + Intronic
933159401 2:79007507-79007529 CGCACCATGCAGAGTGTGGCAGG + Intergenic
936385118 2:112022416-112022438 TGCCCCATGCAGAGTATGGAAGG - Intronic
937398112 2:121556493-121556515 CACCCGGTGCAGAGAGCGGAAGG - Intronic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
938303378 2:130231429-130231451 CACCCCATGCCGAGTGCTCAGGG - Intergenic
938810653 2:134849798-134849820 CACCCCATGCAGATCCTGGCAGG - Intronic
940401626 2:153254620-153254642 CATCCAAAGCAGTGTGTGGAGGG - Intergenic
943283104 2:185963207-185963229 TCCCCCATGCAGAGGGAGGAAGG + Intergenic
944916200 2:204363141-204363163 CAGCCCATGCACAGTGTCGCTGG + Intergenic
945222973 2:207503496-207503518 AGCCCCATGCAGTGTGTGCATGG - Intergenic
947810261 2:232999686-232999708 CACCCCAGCCAGAGGGAGGAGGG + Intronic
947865606 2:233396433-233396455 CACACCATGCTGAGTGCGGTGGG + Intronic
948909798 2:240997340-240997362 CACCCCATGCAGGGTGGGAGAGG + Intergenic
1168836604 20:881804-881826 CACTCTGTCCAGAGTGTGGAGGG + Intronic
1174149925 20:48478628-48478650 CACCCCATGCAGAGCTTGATGGG + Intergenic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1175309736 20:58003491-58003513 CACCCCAGGCTGAGGCTGGAGGG + Intergenic
1175940379 20:62535089-62535111 CACCCTCTGCAGGGTGTTGAAGG - Intergenic
1178514834 21:33237553-33237575 CACCACATCCAGATTGTAGAAGG - Intronic
1178922169 21:36745869-36745891 AACCCCAGGCAGAAGGTGGAAGG + Intronic
1179301565 21:40116152-40116174 CACACCTTTCAGAGGGTGGAGGG + Intronic
1181579893 22:23822316-23822338 CACCCCATGCACTCTCTGGACGG - Intronic
1181747957 22:24968769-24968791 CAACACATGCATGGTGTGGAGGG - Intronic
1184298839 22:43543188-43543210 CACCCCTGGCAAAGTGTGGGAGG + Intronic
1184693637 22:46128359-46128381 GACCCAAAGCAGAGTGTGGGAGG + Intergenic
1184884582 22:47334815-47334837 CATCTCACGCAGAGTGGGGATGG + Intergenic
1184887260 22:47354019-47354041 CACCCCAGGCAGATAGTGGTGGG + Intergenic
1184923391 22:47621326-47621348 CACATCCTCCAGAGTGTGGAGGG + Intergenic
1185093471 22:48790945-48790967 CAAGCCATGCAGAGAGAGGAAGG - Intronic
949627101 3:5879251-5879273 CACCCCATTCAAAGTCTAGAAGG - Intergenic
950199730 3:11034514-11034536 CACGCCCTGGAGAGGGTGGAGGG - Exonic
952307616 3:32160128-32160150 CACCCGATGAAGAGACTGGAAGG - Intronic
952967580 3:38630784-38630806 GACCCCATGCAGGGTGAGGAGGG - Intronic
953100487 3:39820931-39820953 CAACCCAAGCAGAAAGTGGATGG - Intronic
953844184 3:46414214-46414236 CAGCCCCTCCAGAGTTTGGAAGG + Intergenic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956256625 3:67290202-67290224 CATCCCATGGAGAATATGGATGG - Intergenic
957618670 3:82567062-82567084 CACCCAGTGCAGAGGGTGGGAGG - Intergenic
958052242 3:88363121-88363143 CACTGCCTGCAGAGTGGGGATGG + Intergenic
960156065 3:114298152-114298174 CACTACATGCAGGGTGGGGAAGG - Intronic
961768262 3:129229018-129229040 CACCCCAGGCAGAGGGAGAAAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963868718 3:150390460-150390482 GACCCCTTGCAGAGAGAGGATGG - Intergenic
964510403 3:157444080-157444102 CTCCCCATCCACAGTGTGAAGGG - Intronic
964711289 3:159674400-159674422 CAGCCCATGCAGAGTGCCCAGGG + Intronic
967826632 3:193882430-193882452 CTCCCAATCCAGATTGTGGAGGG - Intergenic
969112212 4:4851191-4851213 CACCTCATGCAGAGGCTAGAAGG + Intergenic
974216031 4:58848781-58848803 CACCCTGTGCAGAAGGTGGAAGG - Intergenic
974223243 4:59003465-59003487 TCCCCCATGCAGAGGGAGGAGGG - Intergenic
977620091 4:99126194-99126216 CACCCCATTCTGATTGTGAAGGG + Intronic
985801279 5:2006717-2006739 CCCCCCATCCAGGGTGTGGCAGG - Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
990217768 5:53552955-53552977 CACCCCAAGCAGGGGGAGGAAGG - Intergenic
991198307 5:63960953-63960975 CAGCCCAAGAAGAGTGTGAATGG - Exonic
995189121 5:109302095-109302117 CACCCTATGCTGTGTGTTGAGGG + Intergenic
997549369 5:134738594-134738616 CACCCCTCCCAGACTGTGGACGG + Exonic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
998177183 5:139909033-139909055 AACCTCATGCAGAGTGAGCAGGG + Intronic
998575755 5:143314082-143314104 CACACCAGGCAGAGTTTGGGAGG + Exonic
998955877 5:147437589-147437611 GGCCCCATGGAGAGTGTGGAAGG + Intronic
1001647637 5:173294245-173294267 TGCACCATGCAGAGTGAGGAGGG + Intergenic
1004882625 6:20023740-20023762 CAACCCTTCCACAGTGTGGAAGG - Intergenic
1006357371 6:33567894-33567916 CACCCCCAGCAGGGTGGGGAGGG - Intergenic
1006436143 6:34027066-34027088 GCCCCCATGCAGAGCGGGGAAGG - Intronic
1007695833 6:43733915-43733937 CACCCCAAGGACAGGGTGGAGGG - Intergenic
1008254200 6:49276214-49276236 CACACCTTCCATAGTGTGGAAGG - Intergenic
1019100821 6:169627824-169627846 CAGCCCATGCAGAGGGAGGAGGG + Intronic
1019471735 7:1224762-1224784 CACCCCCTGCACGGAGTGGAGGG - Intergenic
1019521816 7:1464122-1464144 GCCCCCCTGCAGAGCGTGGAAGG + Intergenic
1020109532 7:5440216-5440238 GAACCCATGCAGGGTGGGGATGG - Intronic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1027587545 7:80076642-80076664 AAACCCAAGCAGAGTGAGGAGGG + Intergenic
1028496122 7:91463265-91463287 CACCTCTGGCAGAGGGTGGAGGG - Intergenic
1030007399 7:105132724-105132746 AGCCCCATCCAGAGTGTGAAAGG + Intronic
1032074474 7:128830078-128830100 CAGCCCGTGCGGGGTGTGGAGGG + Intergenic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034921564 7:155087610-155087632 CACCCCCGGCACAGTGGGGACGG - Intergenic
1035468294 7:159093872-159093894 CACCCCATGCCCAGTGCTGACGG + Intronic
1037588598 8:20294972-20294994 TCCCCCAAGCAGAGTGTGGGAGG + Intronic
1040688865 8:49910560-49910582 CACCCGTTGCCGAGTGTGGGTGG + Intronic
1044796864 8:95910179-95910201 CACCCCATTCAGAGATAGGAGGG + Intergenic
1046996812 8:120532730-120532752 GCCCCCATGGAGTGTGTGGAGGG + Intronic
1047207705 8:122816994-122817016 CTCTCCATGCAGATGGTGGATGG + Intronic
1048351800 8:133622552-133622574 CACCCCACATAGAGTGTGAAGGG - Intergenic
1048506551 8:135027046-135027068 CAACACATGCATAGAGTGGAGGG - Intergenic
1049069160 8:140343883-140343905 CACACCCAGCTGAGTGTGGAGGG + Intronic
1049420371 8:142513785-142513807 CAGCCATTGCAGAGTGAGGAAGG + Intronic
1049687103 8:143943407-143943429 CACCCCCTGCTGTGTGTGCAGGG + Intronic
1053375252 9:37600621-37600643 GACCCAAGGAAGAGTGTGGAAGG - Intronic
1055435567 9:76288713-76288735 AACCCCATGCAGACTGTGAAAGG - Intronic
1058672003 9:107367700-107367722 CACCCCATGCAGGGGCTGGCTGG - Intergenic
1061893977 9:133637385-133637407 GACCCCCTGCAGCTTGTGGAAGG - Intronic
1062158258 9:135066025-135066047 CACCCCATGCAGAGGCCTGAGGG - Intergenic
1186016262 X:5198216-5198238 CACACAATGCAGAGTGTAGCTGG - Intergenic
1189107783 X:38255559-38255581 CGGCCCATGTAGAGTGTGGGGGG - Intronic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1191689571 X:63926052-63926074 AAACCCATCCAGAGTGTGTAGGG + Intergenic
1194220352 X:91182398-91182420 CAACCCTTGCAGAGGGTGAAAGG - Intergenic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1200556865 Y:4646150-4646172 CAACCCTTGCAGAGGGTGAAAGG - Intergenic
1202603563 Y:26618947-26618969 AACTCCATGCAGAATGTGGCAGG + Intergenic