ID: 1132942316

View in Genome Browser
Species Human (GRCh38)
Location 16:2514321-2514343
Sequence GGCGGGGGTCGGCGCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132942303_1132942316 15 Left 1132942303 16:2514283-2514305 CCGAGCTGTCGGGGGCGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132942301_1132942316 16 Left 1132942301 16:2514282-2514304 CCCGAGCTGTCGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132942306_1132942316 -2 Left 1132942306 16:2514300-2514322 CCCGGGCCTCGTGTGACAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132942308_1132942316 -3 Left 1132942308 16:2514301-2514323 CCGGGCCTCGTGTGACAGCGGGC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132942312_1132942316 -8 Left 1132942312 16:2514306-2514328 CCTCGTGTGACAGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132942316 Original CRISPR GGCGGGGGTCGGCGCCCCGA GGG Intronic
900100679 1:960808-960830 GGCGGGGGTCGGGGCGCGGGGGG + Intronic
900151798 1:1182139-1182161 GGTGGGGGTCAGCGGCCAGAAGG + Intronic
900283914 1:1890502-1890524 GGCGGCGGCCGGGGCCCCGGGGG - Intronic
900370356 1:2329486-2329508 GGCGGGGGGCTGGGCCCCCAGGG - Intronic
900405934 1:2493007-2493029 GGCTGGGTTCTGGGCCCCGAGGG - Intronic
901092583 1:6651918-6651940 GGCGGGGGGCTGCGCCGGGAGGG - Intronic
901443616 1:9293542-9293564 GGAGGGTGGGGGCGCCCCGACGG - Intronic
903211037 1:21818857-21818879 GGCGGGGGGCGGGGCCAGGAAGG - Intronic
904643018 1:31944715-31944737 GGCGTGGGTCCGCGCGCGGAGGG + Intronic
905584286 1:39105176-39105198 GGCGGGGGTCGGCAGCCCCTGGG + Intronic
906761884 1:48383465-48383487 GGGGGGGGTCAGCCCCCCGCCGG - Intronic
910200060 1:84690293-84690315 GGCGGGGGTGGGCGCCGGCAAGG - Intronic
911042252 1:93600182-93600204 GACTGGGGTCTGCGCCCCCAGGG - Intronic
912354057 1:109041370-109041392 GGCGGGGCTGGGAGCCCCGCTGG - Intronic
914245906 1:145885759-145885781 GGCCGGGGTCGGGGCCACGGGGG + Exonic
914674842 1:149900373-149900395 GGCGGGGGTCCGTGCCTGGATGG - Exonic
914702902 1:150150221-150150243 GGCGCGGGGCGGCGAGCCGAGGG - Exonic
1062861365 10:812987-813009 GGCGAGGGCCGGCCCCCCGCCGG + Exonic
1065025106 10:21534119-21534141 GGAGGGGGACGGGGCCCCGGAGG + Intergenic
1069505189 10:68991173-68991195 GGTGGTGGTTGGGGCCCCGATGG - Intronic
1072617420 10:97059123-97059145 GGCGGGGGACGGGGCCAAGATGG + Intronic
1073136733 10:101224528-101224550 GGCTGGGGGCGGCGGCCCCAGGG - Intergenic
1075464837 10:122643423-122643445 GTCAGGGGTCTGCGCCCCGGTGG - Exonic
1076373934 10:129971445-129971467 GGCGAGGGTCGGCGGCACGGCGG - Intergenic
1076657940 10:132036840-132036862 GGCGGGGGGCGACGTCCCGAGGG + Intergenic
1077228435 11:1448316-1448338 GGCGGGTGGCGCCGCCCCCAAGG + Intronic
1083618120 11:64036227-64036249 GGCGGGGGCCGGGGGCCCGGGGG + Intronic
1083759022 11:64805839-64805861 GGCGGGGGATGGAGCCCCCAGGG + Intronic
1083874858 11:65516859-65516881 CGCGGGGGTCTGGGCCACGATGG + Intergenic
1084693228 11:70738964-70738986 GGAGGGGGTCTGTGGCCCGACGG + Intronic
1091059862 11:132451380-132451402 GGCGGGGGTGGGGGCGCAGACGG + Intronic
1095465198 12:42482893-42482915 AGCGGGCGTCGGCGCCCCCTGGG + Intronic
1095958451 12:47819507-47819529 GGCGGATGTGGGCGCCCCGCGGG + Intronic
1096788293 12:54030297-54030319 GGCGGGGGTGGGGGCGTCGAAGG - Exonic
1096870381 12:54588752-54588774 TGCGGGGGTCACCGCCCCGCGGG + Intergenic
1097155020 12:57006266-57006288 GGCCGGGGTCGGCGCGCGGGCGG + Intronic
1098425821 12:70365656-70365678 GGCGCGGGTCTGCGCCAAGACGG + Intergenic
1099133542 12:78864880-78864902 AGGGGGGCTTGGCGCCCCGAAGG + Exonic
1103410775 12:120710346-120710368 GGCGGGGGCGGGCGCCCGGGGGG - Intergenic
1104841493 12:131828150-131828172 GGCGGGGGTCGGGGCGCCTGCGG - Intergenic
1106776645 13:33016256-33016278 GGCGGGGGCAGGGGCGCCGAGGG - Intergenic
1106776682 13:33016343-33016365 AGCGGGGGTGGGCGCGCCGGCGG + Intergenic
1107467636 13:40665125-40665147 GGCGGGGGAGGGCGCGGCGAGGG - Intronic
1108662613 13:52600358-52600380 GGCGGGCCTCGGCGCCCAGGCGG - Intergenic
1112402198 13:99086710-99086732 GGCGGGGCGGGGCGCCCGGACGG + Intergenic
1113457378 13:110458222-110458244 GGCAGGGGTTGGCTCCCCCAGGG - Intronic
1115576243 14:34714673-34714695 GGCGGGGCTCGGCGGGCCGCAGG + Exonic
1119046197 14:71320736-71320758 TGCGGGGGTCCGGGCTCCGAAGG - Intronic
1122922719 14:104886602-104886624 GGCGGGAGTTGGCTCCCCGGGGG - Exonic
1123025034 14:105420264-105420286 GGCGGGGCTCGGCGGCCCGGGGG + Intronic
1124109228 15:26772185-26772207 GGCTGGCGTCGGAGCCGCGAGGG - Intronic
1125300676 15:38251879-38251901 GGCGGGGGTGGGAGCTGCGAGGG - Intergenic
1125508934 15:40282650-40282672 GGCGGAGGCCGGAGCCCCGCGGG - Intronic
1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG + Exonic
1127117461 15:55742706-55742728 GCCGGGGGTCAGCGCCACCACGG + Intronic
1127922693 15:63505194-63505216 GGCGGGTGTCCGGCCCCCGAGGG + Intronic
1128970186 15:72100870-72100892 GGGGGGGGTCAGCCCCCCGCCGG + Intronic
1129322269 15:74781998-74782020 GGCAGGGGGCGCCGCCCCGCCGG + Intergenic
1129975350 15:79816881-79816903 GGCGGGGGTGGGGTCCCAGAGGG + Intergenic
1132304641 15:100802451-100802473 CGGGGGGGTGGGCGCCCCCAAGG - Intergenic
1132549410 16:548172-548194 GGCGGGGGGCCGCGCCCCTGAGG + Exonic
1132734620 16:1379349-1379371 AGGCGGGGTCGGTGCCCCGAGGG - Intronic
1132889326 16:2196297-2196319 GGCGCGGGTGGGAGCCCCGGGGG - Intronic
1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG + Intronic
1133286744 16:4694248-4694270 GGCGGGGGGCGGGGCCCGGGCGG - Intronic
1136426277 16:30170101-30170123 TGGGGGGGTCGGCCCCCCGCCGG + Intergenic
1141770188 16:86085231-86085253 GGCGGAGGTGGGTGCCCCGTGGG - Intergenic
1142762404 17:2050194-2050216 GGCCGGGGGCGGGGCCCTGAGGG + Intergenic
1143499207 17:7329233-7329255 GGCGGGGGTGGGGGCCCCAGCGG - Exonic
1143598472 17:7929449-7929471 GGCGGGGGAGGGGGCTCCGAGGG + Intronic
1145765535 17:27456317-27456339 GGCGCGGTCCGGGGCCCCGAGGG + Intergenic
1146271436 17:31488182-31488204 GGCGCGGGTCGGCGGCGCGCGGG - Intronic
1147044409 17:37742759-37742781 TGCGGGTGTCGGCGACCCGGGGG + Intronic
1148911357 17:50944745-50944767 GGCGGGGGAGGGCGCACAGAGGG - Intergenic
1150108362 17:62478440-62478462 GGCGGGGGCCGGCGACACAAAGG + Intronic
1151812549 17:76453025-76453047 GGCGGGCGCCGGCGCCGGGACGG + Exonic
1151852952 17:76701734-76701756 GGCAGGGGTTGGGGCCCGGATGG - Intronic
1152617845 17:81346053-81346075 GGTGGGGCTGGGCGCCCCGGAGG - Intergenic
1153805566 18:8706178-8706200 GGCCGGGGTCGGGGGGCCGACGG - Intronic
1153855089 18:9137210-9137232 GGCGGCGGGCGGGGCCCCGGCGG - Intronic
1158579756 18:58671382-58671404 GGCGGGGCACGGAGCCTCGAGGG - Exonic
1160828794 19:1093278-1093300 GGCGTGGGGCTGCGCCCCTAAGG + Intronic
1160853645 19:1206305-1206327 GGCGGGAGTCGGCGCCCCCCGGG + Intronic
1160867010 19:1260541-1260563 GGTGGGGGTCGGCATCCCGAGGG - Intronic
1162798415 19:13098281-13098303 GGGGGAGGGGGGCGCCCCGAGGG - Intronic
1166294618 19:41883027-41883049 GGCGGGGGCCGGTGCCCGCAGGG + Intergenic
1166986230 19:46661197-46661219 GGCGCGGGTGGGCGGCCCAATGG - Intergenic
1168078162 19:53991741-53991763 GTCGGGGGTGGGAGCCCCGAGGG + Intergenic
925156027 2:1649427-1649449 GGTGGGGGTTGATGCCCCGAGGG + Exonic
925611678 2:5706773-5706795 GGTGGGGCACGGCGCCCCGGAGG + Intergenic
927558157 2:24050107-24050129 GGCGGGGGTCTGCGGCCCGGAGG + Intronic
927809347 2:26173048-26173070 GGCCGGGGTCGGCGCCCTGCGGG + Intergenic
929701855 2:44169145-44169167 GGCGGCGGTCGAGACCCCGAGGG + Exonic
929857847 2:45651239-45651261 GGCGGGCGCCGGCGCCCAGGAGG + Intergenic
934746163 2:96761012-96761034 GGCGGGGGCGGGCGCCCGGTCGG + Exonic
936462559 2:112723622-112723644 GGCTGGGGTGGGCTCCCAGAAGG + Intronic
936860516 2:117012468-117012490 GGCGGGGGGGTGAGCCCCGAGGG + Intergenic
937933020 2:127220100-127220122 GGCCGGGGTCGCCGCCGGGAGGG - Intergenic
941906163 2:170717047-170717069 GGCGGCGGGCGGCGCCCCCGAGG + Exonic
947118015 2:226791865-226791887 GGCGGGGGCGGGAGACCCGAGGG + Intronic
947122948 2:226836193-226836215 GGCGGAGGTCGGCGCCTCCCGGG + Intronic
948807175 2:240458003-240458025 GGCGGGGGACGAGGCCCAGAAGG + Intronic
948941595 2:241199667-241199689 GGCGGGGGTCTGGGCCTGGAGGG - Intronic
949046189 2:241873626-241873648 GGCGGGGGGCGGGGCCTCGGAGG - Exonic
1169345086 20:4823086-4823108 GGCGGGGGTCCGCGCGCCCCGGG + Intronic
1172876124 20:38165315-38165337 GGCCGGGGGCGGGGCCCCGCGGG + Exonic
1173982935 20:47238984-47239006 GGCGGGGGCCGGGGCCGTGACGG + Exonic
1175847401 20:62065899-62065921 GGCGGGGGGCGGCGCGCGGCCGG + Intergenic
1176549433 21:8214867-8214889 CGCGGGGGTGGGCGCCGGGAGGG - Intergenic
1176550301 21:8217958-8217980 GGCGGGGGGGCGAGCCCCGAGGG + Intergenic
1176557328 21:8259096-8259118 CGCGGGGGTGGGCGCCGGGAGGG - Intergenic
1176568361 21:8397901-8397923 CGCGGGGGTGGGCGCCGGGAGGG - Intergenic
1176569229 21:8400996-8401018 GGCGGGGGGGCGAGCCCCGAGGG + Intergenic
1176576270 21:8442131-8442153 CGCGGGGGTGGGCGCCGGGAGGG - Intergenic
1176577143 21:8445228-8445250 GGCGGGGGGGCGAGCCCCGAGGG + Intergenic
1178610238 21:34073491-34073513 GGCGGGGCGGGGCGCGCCGAGGG + Intronic
1178673800 21:34614582-34614604 GCGTGGGGACGGCGCCCCGAGGG - Intronic
1180649977 22:17369589-17369611 GGCGGGGGGCGGCGGCGCGGGGG - Exonic
1181941883 22:26483976-26483998 GGAGGGAGGCGGCGCCCCGGGGG + Exonic
1183601560 22:38843333-38843355 GGCGGGGCCCGGCGCCCTGGAGG + Exonic
1183601818 22:38844238-38844260 CGCAGGGGCCGGCGACCCGAGGG + Intergenic
1184243958 22:43226642-43226664 GGCGGGGTTCTGAGCCCAGAGGG + Intronic
1184265466 22:43343635-43343657 GGCGGGGGCCGGGGCGCCGCGGG - Intergenic
1184347574 22:43923163-43923185 GGCTGGGGTCGGGGCCCTGTAGG - Intergenic
1184472143 22:44702154-44702176 GGCGGGTCTCGGCGCCCCGGGGG - Intronic
1203254320 22_KI270733v1_random:131189-131211 CGCGGGGGTGGGCGCCGGGAGGG - Intergenic
1203255196 22_KI270733v1_random:134296-134318 GGCGGGGGGGCGAGCCCCGAGGG + Intergenic
1203262376 22_KI270733v1_random:176268-176290 CGCGGGGGTGGGCGCCGGGAGGG - Intergenic
1203263252 22_KI270733v1_random:179375-179397 GGCGGGGGGGCGAGCCCCGAGGG + Intergenic
952377656 3:32780901-32780923 AGAGGGGGGCGGCGCCCCGGGGG + Intergenic
953947979 3:47164784-47164806 GGTGGAGGTAGGAGCCCCGAGGG - Intergenic
954389250 3:50260299-50260321 GGCCGGGGTCGGCGCCGCGGAGG + Intergenic
956761297 3:72447200-72447222 GGCGGCGGCCGGCGCCGCGAGGG + Intergenic
960664164 3:120094213-120094235 GACGGGGGAGGGGGCCCCGAGGG - Intronic
965977296 3:174641005-174641027 GGCGAGGATGGGCGCCCCAAAGG + Intronic
967849409 3:194070941-194070963 GGAGGAGGGCGGCGCTCCGAAGG + Intergenic
968922910 4:3531961-3531983 GGTGGCGGCCGGCACCCCGAGGG - Intronic
971257879 4:25030710-25030732 GGTGGGGGTCGGGGCCCGGGCGG - Exonic
971294505 4:25376991-25377013 GGCGGGGCAGGGAGCCCCGAGGG - Intergenic
972671522 4:41216635-41216657 GGCGGTGTTCTGCGCCCCGTCGG + Intronic
985660795 5:1155755-1155777 GGCCGGGGTCGGGGGCCCGGCGG + Intergenic
990955157 5:61332821-61332843 CGCGGGGGCCGGGGCCCCGTCGG + Exonic
995193539 5:109342000-109342022 TGGGGGGGTCGGCCCCCCGCCGG + Intronic
997177723 5:131796793-131796815 GGCGGGGGTCGCGGAGCCGATGG - Intronic
1000296295 5:159916290-159916312 GGCGGGGGCAGGGGCCGCGAGGG - Intergenic
1002006405 5:176238338-176238360 GGCGGGGCTTGGCGGCCCGGCGG + Intergenic
1002219975 5:177672299-177672321 GGCGGGGCTTGGCGGCCCGGCGG - Intergenic
1003552297 6:7109368-7109390 GGAGGGGGTCGGCGACGGGAAGG - Intronic
1004614926 6:17280949-17280971 GCCGGGGGTCGACGCCCGGCTGG - Intergenic
1006475331 6:34249155-34249177 GGCGGGGGTGGGCGGTGCGAAGG + Exonic
1013366189 6:109440344-109440366 GGCGGGGGTCGAGGCCCCACCGG - Intronic
1015905008 6:138107604-138107626 GGCGGCGGAAGGCGGCCCGAGGG + Intergenic
1016433053 6:144008090-144008112 TCCGGGGGTCGTCGCCCCGCAGG - Intronic
1018757579 6:166863029-166863051 GGCGGGGGGGGGCGGCCCGTGGG + Intronic
1018929022 6:168227733-168227755 GGCATGGGACGGCGCCACGAAGG - Intergenic
1019379000 7:711842-711864 GGGGGGGCCCGGCGCCCTGAGGG + Intronic
1019714977 7:2534411-2534433 GGGGGGGGTCAGCCCCCCGCCGG - Intergenic
1022697932 7:32728420-32728442 GCCGCCGCTCGGCGCCCCGAGGG - Intergenic
1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG + Intergenic
1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG + Exonic
1027070628 7:75157865-75157887 AGCGGGGGGCGCCGCCCCGCAGG - Intergenic
1029390560 7:100271617-100271639 GGTGGGGGGTGGCGCACCGAGGG + Intronic
1033648599 7:143323265-143323287 GGCGGGGGTCAGAGGCCAGATGG - Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1039936535 8:42051486-42051508 GGCGGGTGGGCGCGCCCCGAGGG + Intronic
1049396346 8:142402942-142402964 GGCGGGGGGCGGGGCCGCGCCGG - Intronic
1049850372 8:144827307-144827329 GGCAGGGGGCGGAGCCGCGAGGG - Intergenic
1051689488 9:19695076-19695098 GGCGGGGGTGGGCTTCCCCAGGG + Intronic
1057054253 9:91949326-91949348 GGCGGGGGTGGGGGCGCCGGCGG - Intronic
1057995727 9:99820531-99820553 GGCGGGGGGCGCTGCGCCGAGGG - Intergenic
1060230635 9:121822699-121822721 TGTGGGGGCCGGCCCCCCGACGG + Exonic
1060814833 9:126629564-126629586 GGCTGGGGTTGGTGCCCCGATGG + Intronic
1060832022 9:126722942-126722964 GGCGGGGGCGGGCGCCCCGGGGG - Intergenic
1061976007 9:134068241-134068263 GGCGGGGCTCGGCGCCCGCCCGG + Intronic
1062162478 9:135087851-135087873 GGCGGGCGGCGGCGGGCCGAGGG + Exonic
1062461888 9:136665744-136665766 GGCGGGGCTCGGGGCCCCCACGG + Intronic
1203470721 Un_GL000220v1:114333-114355 CGCGGGGGTGGGCGCCGGGAGGG - Intergenic
1203471594 Un_GL000220v1:117433-117455 GGCGGGGGGGCGAGCCCCGAGGG + Intergenic
1203478542 Un_GL000220v1:158305-158327 CGCGGGGGTGGGCGCCGGGAGGG - Intergenic
1203479415 Un_GL000220v1:161405-161427 GGCGGGGGGGCGAGCCCCGAGGG + Intergenic
1189262626 X:39689154-39689176 GGCGGGGACCGGCGCCCTGAGGG + Intergenic
1200100940 X:153688869-153688891 GGCGGGGGCCGGCGGCCTGCTGG - Intronic