ID: 1132942316

View in Genome Browser
Species Human (GRCh38)
Location 16:2514321-2514343
Sequence GGCGGGGGTCGGCGCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132942312_1132942316 -8 Left 1132942312 16:2514306-2514328 CCTCGTGTGACAGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132942301_1132942316 16 Left 1132942301 16:2514282-2514304 CCCGAGCTGTCGGGGGCGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132942308_1132942316 -3 Left 1132942308 16:2514301-2514323 CCGGGCCTCGTGTGACAGCGGGC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132942303_1132942316 15 Left 1132942303 16:2514283-2514305 CCGAGCTGTCGGGGGCGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132942306_1132942316 -2 Left 1132942306 16:2514300-2514322 CCCGGGCCTCGTGTGACAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132942316 Original CRISPR GGCGGGGGTCGGCGCCCCGA GGG Intronic