ID: 1132942798

View in Genome Browser
Species Human (GRCh38)
Location 16:2516530-2516552
Sequence CTGGGGACACAGCTGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 475}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132942798_1132942806 0 Left 1132942798 16:2516530-2516552 CCAACCTCCAGCTGTGTCCCCAG 0: 1
1: 0
2: 7
3: 53
4: 475
Right 1132942806 16:2516553-2516575 CTCCTGGCCCTTGGCCTGCCTGG 0: 1
1: 0
2: 3
3: 48
4: 469
1132942798_1132942810 9 Left 1132942798 16:2516530-2516552 CCAACCTCCAGCTGTGTCCCCAG 0: 1
1: 0
2: 7
3: 53
4: 475
Right 1132942810 16:2516562-2516584 CTTGGCCTGCCTGGCACTGACGG 0: 1
1: 0
2: 6
3: 49
4: 290
1132942798_1132942812 14 Left 1132942798 16:2516530-2516552 CCAACCTCCAGCTGTGTCCCCAG 0: 1
1: 0
2: 7
3: 53
4: 475
Right 1132942812 16:2516567-2516589 CCTGCCTGGCACTGACGGATTGG 0: 1
1: 0
2: 2
3: 9
4: 117
1132942798_1132942802 -9 Left 1132942798 16:2516530-2516552 CCAACCTCCAGCTGTGTCCCCAG 0: 1
1: 0
2: 7
3: 53
4: 475
Right 1132942802 16:2516544-2516566 TGTCCCCAGCTCCTGGCCCTTGG 0: 1
1: 0
2: 6
3: 99
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132942798 Original CRISPR CTGGGGACACAGCTGGAGGT TGG (reversed) Intronic
900094616 1:935192-935214 CCGGGGGGACAGCGGGAGGTTGG + Intronic
900095019 1:936697-936719 TGGGGGACACAGATGGGGGTGGG - Intronic
900151948 1:1182671-1182693 CTGGGGCCAGGGCTGGAGCTTGG + Intronic
900333763 1:2150507-2150529 CTCTGGTCACAGCTGCAGGTGGG - Intronic
900423144 1:2564386-2564408 CTGGGGGCTCTGCTGGAGGCAGG - Intronic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900796445 1:4711442-4711464 CTGGGGTCCCAGGTGGAGGCCGG + Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901465759 1:9419990-9420012 CTGAGGACTCAGCCTGAGGTAGG + Intergenic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902376498 1:16032432-16032454 CTGGAGACACTGCTGGGAGTGGG - Exonic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902392986 1:16116905-16116927 CTGGGGAGACAGCAAGGGGTGGG - Intergenic
902744794 1:18466577-18466599 CTGAGGCCACATCTGGAGGGAGG - Intergenic
902991399 1:20189866-20189888 CTGGTGGCAGAGCTGGAGATAGG - Intronic
903219301 1:21860080-21860102 CTGGGGACAGGGCTGAGGGTGGG - Intronic
903703469 1:25267849-25267871 CTGGGTTCACAGCTGGACGTCGG - Intronic
903712736 1:25338178-25338200 CTGGGTTCACAGCTGGACGTCGG - Exonic
904354556 1:29930672-29930694 TTGAGGACAGAGCTGGGGGTGGG - Intergenic
904396889 1:30228124-30228146 CAGGGGACACTGCTGGGGATTGG + Intergenic
904517923 1:31071219-31071241 ATGGGGAGGCAGCTGAAGGTTGG - Intergenic
904600655 1:31670969-31670991 CTCGGGGGACAGGTGGAGGTCGG - Intronic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
906152929 1:43598449-43598471 ATGGGGGAACAGGTGGAGGTGGG - Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
908356417 1:63328210-63328232 CCGGGGACACAGGTGGAGTCCGG - Intergenic
911164396 1:94712096-94712118 CAGGCCACACAGCGGGAGGTGGG + Intergenic
911337325 1:96596401-96596423 CTAGGGGCAGACCTGGAGGTGGG - Intergenic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG + Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
916059518 1:161089050-161089072 CTGGGGGCACTGCTGGAAGCTGG + Intronic
916205048 1:162308309-162308331 GTGGGCACACAGGTGGAGTTGGG + Intronic
916554467 1:165882140-165882162 CTGGGTAAATATCTGGAGGTCGG + Intronic
917207307 1:172590775-172590797 CTTGGGATGCAGATGGAGGTAGG - Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917509415 1:175657996-175658018 CTGGGAACCCAAGTGGAGGTAGG - Intronic
919802882 1:201364233-201364255 CTGGGGGCCCAGCAGGAGCTGGG + Intronic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920100767 1:203515720-203515742 CAGGGGAGAAAGGTGGAGGTGGG + Intergenic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
922307495 1:224357026-224357048 CGGGGGACACGGCTGAGGGTGGG + Intronic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924557187 1:245128491-245128513 CTGGGGACAGGGCTGGAGATGGG + Intergenic
1062905321 10:1175870-1175892 ATGGGGGCAGAGGTGGAGGTGGG - Intergenic
1062928948 10:1339947-1339969 GTGGGCTCACAGCTGGGGGTGGG + Intronic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063337848 10:5233954-5233976 CTGGGAATACAGCTATAGGTGGG + Intergenic
1063432086 10:5999670-5999692 CTGGGGCCAGAGCTGCAGGCAGG - Intergenic
1063463690 10:6229942-6229964 CGGGCCACACAGCAGGAGGTGGG - Intronic
1063703211 10:8405777-8405799 CTTGGGACACACTTGGAGGGAGG + Intergenic
1063856016 10:10254943-10254965 CTGGGGACCCAGCTTTAGGGAGG + Intergenic
1065032520 10:21602314-21602336 CGGGGGAGCCAGCTGGGGGTAGG - Intronic
1065562850 10:26980828-26980850 CTGGGGATGTACCTGGAGGTGGG + Intergenic
1066269981 10:33812952-33812974 CTGGGGACACTGCTTGTGGCTGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066340589 10:34529103-34529125 CCTGGGACACAACTGGAGATGGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067227287 10:44384515-44384537 CTGCGCACAGTGCTGGAGGTCGG - Intronic
1067302973 10:45031342-45031364 GTGGGGGCACAGCTGGGGGGTGG - Intergenic
1068698593 10:59995761-59995783 CTAGGAACACACCTGGAGTTGGG + Intergenic
1069884568 10:71615673-71615695 CCTCGGACACTGCTGGAGGTTGG - Intronic
1070505844 10:77112010-77112032 CTGGGGACAAGGTTGGAAGTTGG - Intronic
1070785677 10:79160971-79160993 CTGGGGTCTCAGCTGGAGGCTGG - Intronic
1071396164 10:85226100-85226122 GTGGGGCCAATGCTGGAGGTGGG - Intergenic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1073107132 10:101038655-101038677 CTGGGGGCACCCCTGCAGGTGGG + Exonic
1073327421 10:102650777-102650799 CTGGGGAGGCAGGTGGGGGTTGG + Intronic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1073443168 10:103564767-103564789 CAGAGGGGACAGCTGGAGGTGGG - Intronic
1073560903 10:104496037-104496059 CTGGGGCCACATATGGAGGGAGG - Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076787979 10:132760513-132760535 CTGGGGTCACTGCAGAAGGTTGG + Intronic
1076817288 10:132921217-132921239 CTGGGCACTGAGCTGGAGGGAGG + Intronic
1077496278 11:2887996-2888018 CCAGGGACACACCTGGAGGAAGG + Exonic
1077541780 11:3150092-3150114 CAGGGGAAACAGCTGCTGGTTGG - Intronic
1078110659 11:8389203-8389225 CAGGGGACACAGCTGTAAGAGGG + Intergenic
1078665182 11:13318720-13318742 CTGTGGCCACATCTGGAGGGTGG + Intronic
1078832128 11:14987836-14987858 CTGGTGACACAGCTGAAGTCAGG + Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079693907 11:23454823-23454845 TTGGAGAAACACCTGGAGGTGGG + Intergenic
1080443789 11:32318599-32318621 CTGAGTCAACAGCTGGAGGTAGG + Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1082093705 11:48109764-48109786 CCGGGGAGAGGGCTGGAGGTGGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083389565 11:62337832-62337854 CTGGGTTCGCAGCTGGGGGTGGG - Intronic
1083423599 11:62570849-62570871 CTTGGAAAACAGCTAGAGGTGGG - Intronic
1083576704 11:63797120-63797142 CTGGGTACACAGCAGGTGATGGG - Intergenic
1083840018 11:65299086-65299108 CTGGTGACACAGCTGAAGTGGGG - Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1084321888 11:68377788-68377810 CTGGGAGCAGAGCTGGGGGTGGG + Intronic
1084469171 11:69345394-69345416 CTGGGGACAAGCCTGGAGATGGG - Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1084964999 11:72739874-72739896 AGGGGGACATGGCTGGAGGTAGG - Intronic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085311292 11:75518392-75518414 CTTGGGACACTGTGGGAGGTAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086435272 11:86773845-86773867 TTTGGGGCACAGCTGGAGGGAGG - Intergenic
1086438610 11:86805885-86805907 CTGGGAACACAGCAGAAGTTAGG - Intronic
1087277647 11:96176446-96176468 CAGGGGACTCATCTTGAGGTAGG + Intronic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1092077114 12:5683145-5683167 TAGGGGGCAGAGCTGGAGGTAGG - Intronic
1092160225 12:6311754-6311776 CTTGGGAAAAAGCTGGAGGGAGG - Intronic
1092861725 12:12724837-12724859 CTGCGGGCCCAGCTGGGGGTGGG + Intergenic
1095226336 12:39681306-39681328 CTGGGGACTCTGGTGGAGGGTGG + Intronic
1095797739 12:46238734-46238756 CTGAGGACACAGCTAGTGGCTGG + Intronic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1097287743 12:57890471-57890493 CTGTGGACAAAGCTGGATATTGG + Intergenic
1100263454 12:92954088-92954110 GAGGGGACACGGCAGGAGGTGGG + Intergenic
1100860743 12:98803697-98803719 CTGGGAACAGGGCTGGGGGTGGG + Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101857595 12:108456832-108456854 CCAGGGACACAGCGGGAGGCCGG - Intergenic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1102648226 12:114417793-114417815 CTGAGGACATGGCTGGAGATGGG - Intergenic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1104013675 12:124948987-124949009 CTGGGCACAAATCTGGAGGAAGG - Intronic
1104070719 12:125343058-125343080 AAAGGGATACAGCTGGAGGTAGG + Intronic
1104803048 12:131567841-131567863 CTGGGGACTCAGCTGGACCCTGG - Intergenic
1105759020 13:23496080-23496102 CTGGGCACACAGCTGGTCTTGGG - Intergenic
1106229190 13:27808621-27808643 GTGGGGACACACCGGGAAGTTGG + Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1109013450 13:56978551-56978573 GTGAGGACACAGCCAGAGGTTGG + Intergenic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110596501 13:77326462-77326484 CTGGGGACGCACCTGGAGGCTGG + Exonic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1113437315 13:110303337-110303359 CTGGGGCCTCAGTTGGAGCTGGG + Intronic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113873720 13:113581442-113581464 CACGGGACAGACCTGGAGGTTGG + Intergenic
1113897544 13:113775725-113775747 CTGGGCACCCAGCTCGGGGTTGG + Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114218097 14:20672800-20672822 CTGGGGAGATTGCTGGCGGTGGG - Intergenic
1114504175 14:23196331-23196353 CTTGGAAGCCAGCTGGAGGTTGG - Intronic
1117800224 14:59435701-59435723 CTGGGGGCACCCCTGGAGTTGGG - Intronic
1118038578 14:61893809-61893831 ATGGTGGCAGAGCTGGAGGTAGG + Intergenic
1118717889 14:68573278-68573300 GAGGGGGCACAGCAGGAGGTGGG - Intronic
1119642748 14:76327229-76327251 CTGGGGACCCACGTGGGGGTGGG + Intronic
1119658889 14:76436694-76436716 CTGGGGACTCCACTGGTGGTTGG + Intronic
1121798104 14:96752372-96752394 GTGGGGACATGACTGGAGGTGGG + Intergenic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG + Intergenic
1123026097 14:105424988-105425010 CTGGGGACCCACCTCTAGGTAGG - Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1124159049 15:27252693-27252715 CTGGGGTCAGACCTGCAGGTGGG - Intronic
1125585462 15:40816165-40816187 CAGAAGACTCAGCTGGAGGTAGG - Exonic
1125589422 15:40844997-40845019 CTGGGTCCGCAGCTGGCGGTAGG - Exonic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1125834139 15:42735974-42735996 CTGGGGACACAGCTGATTGGGGG + Exonic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1128318689 15:66677879-66677901 CAGGGGACACATTTGGAGGTTGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128368268 15:67020273-67020295 CTTGGGACTCAGCTGCTGGTGGG - Intergenic
1128823860 15:70691043-70691065 CTGTTGACATAGCTGAAGGTTGG - Intronic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1129120405 15:73393078-73393100 GTGAGGACACAGCTAGACGTTGG - Intergenic
1129361927 15:75029708-75029730 CTGGGTACACAGCGGGTGGCTGG - Intronic
1130085338 15:80773924-80773946 CAGTGCTCACAGCTGGAGGTAGG + Intergenic
1130350269 15:83085184-83085206 GTGGGGAGGCAGCAGGAGGTGGG + Intergenic
1130570325 15:85036954-85036976 CTGGGGAAGAAGCTGGGGGTGGG - Intronic
1130925200 15:88380328-88380350 GTGGGGTCACTGTTGGAGGTCGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131653146 15:94423988-94424010 CTGGGGACAAAGCAGGAAGGAGG - Intronic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1132856293 16:2046395-2046417 GTGGGGCCACAGGTGAAGGTAGG + Intronic
1132897474 16:2235942-2235964 CTGGGGGCACAGCTCCAGCTGGG - Exonic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133059473 16:3165109-3165131 ATGGGGACACAGATTGAGTTGGG - Intergenic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1135281578 16:21157896-21157918 TTTGAGACACAACTGGAGGTGGG + Intronic
1135415746 16:22266888-22266910 GCGGGGACCCAGCTGCAGGTGGG + Intronic
1135763008 16:25152721-25152743 GTGGGGACAGAACTGGAGGATGG - Intronic
1135808966 16:25570049-25570071 TGTGGGACAGAGCTGGAGGTGGG + Intergenic
1135954076 16:26940998-26941020 CGAGGGGCACAGCTGGAGGAGGG + Intergenic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136609447 16:31357230-31357252 CTGGGGACACAGCGGGCTGCTGG - Intronic
1137836446 16:51597028-51597050 CTGGGGACAATGTTGGAGGTGGG + Intergenic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1139526807 16:67521721-67521743 CTGGGGACACCGCCTGAGGCTGG - Intronic
1140055987 16:71526210-71526232 GTGGGGAGACTGCTTGAGGTGGG - Exonic
1140091799 16:71845567-71845589 TTGGGGACCCAGGTGGAGATAGG - Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142026676 16:87818136-87818158 CAGCGGACACAGCTGGAGAGCGG + Intergenic
1142132686 16:88438104-88438126 CGGGGGACACTCCTGGTGGTTGG - Exonic
1142227640 16:88885316-88885338 CCGGGGACAGAGGTGCAGGTGGG + Intronic
1142286906 16:89175202-89175224 CGGTGGAGGCAGCTGGAGGTTGG + Intronic
1142382264 16:89739610-89739632 CTGGGGACACCCCTGGGGGTCGG + Intronic
1142400346 16:89855335-89855357 CCTGGGACTCATCTGGAGGTGGG - Intronic
1142607647 17:1090925-1090947 CAGGGGACACAGCCAGAGATGGG + Intronic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1142787808 17:2237952-2237974 TTGGGGAAACAGCTCCAGGTTGG + Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1142899188 17:3001921-3001943 CTAGCACCACAGCTGGAGGTGGG - Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143397721 17:6615767-6615789 TTGAGGACACTGCTGGTGGTGGG + Intronic
1143626186 17:8111354-8111376 CTGCAGACAGAGCTAGAGGTGGG - Exonic
1145868370 17:28255160-28255182 TTGAGGACACAGCTCCAGGTGGG + Intergenic
1145902933 17:28499729-28499751 CTGGGGACACAGCTCGAATCAGG - Intronic
1145909290 17:28533316-28533338 CCTGGAACAGAGCTGGAGGTGGG + Intronic
1146030717 17:29363883-29363905 GTGAGGACACAGCTGGAAGTTGG - Intergenic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1147631994 17:41938241-41938263 CTGAGGACACAGCTTGAACTGGG + Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1149284776 17:55150311-55150333 ATGAGGACACAGCCAGAGGTAGG - Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1149985498 17:61343955-61343977 CTGGGGACCTGGCTGGATGTGGG + Intronic
1150131605 17:62672196-62672218 CTGGGGTGGCACCTGGAGGTTGG - Intronic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1151700042 17:75737934-75737956 CTGGGGACCCTGGTGGGGGTTGG - Intronic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1152430581 17:80246400-80246422 CTGGGGACAGGGGTGGGGGTAGG - Intronic
1152431771 17:80252222-80252244 CTGAGGTCACAGCTGAAGCTGGG + Intronic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157566849 18:48684146-48684168 GTGGGGCCACAGGTGCAGGTGGG + Intronic
1157779752 18:50427768-50427790 CTGGGGACATAGTGGGAGGCAGG + Intergenic
1157809369 18:50683795-50683817 CTGGCAACACAGCTGGATGTAGG + Intronic
1158550398 18:58430989-58431011 TTGGGGACAAAGGTGGGGGTGGG - Intergenic
1159084139 18:63768806-63768828 CTGGGGCCAGGGCTGGAGGGAGG - Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160596954 18:79982457-79982479 CTGGGATCACTGCTGGATGTAGG - Intronic
1160844039 19:1158904-1158926 GTGGGGTCACGGCTGCAGGTGGG - Intronic
1160844049 19:1158940-1158962 GTGGGGTCACGGCTGCAGGTGGG - Intronic
1160890470 19:1375356-1375378 ATGGGGACAGAGCTGTAGTTTGG - Intronic
1161041654 19:2113622-2113644 CCGGGGACAAAGCTGTGGGTGGG + Intronic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1161138981 19:2636981-2637003 GTGGGGACAGAGGTGCAGGTGGG - Intronic
1161149874 19:2702207-2702229 CTGGGGAGGGGGCTGGAGGTGGG - Intronic
1161335087 19:3708657-3708679 CCGGGGAGACAGCTCGTGGTGGG - Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162133037 19:8538877-8538899 CTGGGGACACAGTTTCAGTTTGG + Intronic
1162155240 19:8673440-8673462 CTGGGGAAGCAGCTGCAGTTAGG - Intergenic
1162730749 19:12717018-12717040 CTGGTGACAGAGCTGGATATGGG + Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163115679 19:15187560-15187582 GTGGGGCCACAGCTGGGGGCGGG - Intronic
1163125766 19:15243392-15243414 CTGGTGACACGGCTGGGGGCCGG + Exonic
1163328452 19:16620315-16620337 CAGCGGACACAGCTGGAAGGAGG - Intronic
1163659727 19:18569451-18569473 CTGGGGGCCCTGCTGGAGGGAGG + Intergenic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164717929 19:30407075-30407097 CTGGGGTCACAGCAGGTGGCTGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165475213 19:36026465-36026487 CTGAGGAGATAGCGGGAGGTTGG - Intronic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166369628 19:42293684-42293706 CAGGGGCTACAGCTGGAGCTGGG - Exonic
1166424299 19:42662167-42662189 CAGTGGACACAGCAGGAGTTTGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166766488 19:45254350-45254372 CAGGGCAGCCAGCTGGAGGTGGG - Intronic
1166777271 19:45320706-45320728 CTGGCCACACAGCTGGTTGTAGG - Intronic
1167502068 19:49854109-49854131 CTGGGGCAAAGGCTGGAGGTGGG + Intronic
1167560720 19:50225502-50225524 CTGGAGACACAGCCCGAGCTGGG + Intronic
1168266953 19:55228515-55228537 CTGGGGTCCCAGGTGGGGGTGGG - Intronic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168400993 19:56086356-56086378 CTGGGGCCTCATCTGGAGGCAGG - Intergenic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
926622263 2:15057574-15057596 TTGGGGGAAGAGCTGGAGGTTGG - Intergenic
927156101 2:20222747-20222769 CTGGGGAGGCAGGTGGAGTTTGG - Intronic
927454945 2:23241317-23241339 CTGGAGACAGAGCAGAAGGTGGG + Intergenic
927518940 2:23687821-23687843 CAGGGGACGCGGCTGGAGGGAGG + Intronic
927523447 2:23716837-23716859 GTGAGGGCACAGTTGGAGGTGGG - Intergenic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
928367919 2:30716953-30716975 CTGGGGCCACAGGTGCTGGTAGG - Intergenic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928660384 2:33495852-33495874 TTGGGGAGACAGCCGAAGGTAGG + Intronic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929717037 2:44322726-44322748 CTAAGGACACAGGTGAAGGTAGG - Exonic
931935117 2:67188082-67188104 CTGGGGACAAAGCCTGAGCTTGG + Intergenic
933709381 2:85314483-85314505 CTCAGGACTCAGCTGGAGGGAGG - Intergenic
935213139 2:100955429-100955451 CCCGGGACACAGCTGGTGGAGGG + Intronic
935296739 2:101656386-101656408 CTGGAAACAGACCTGGAGGTGGG - Intergenic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936159402 2:110072214-110072236 CTGGGGAGCCCGCTGGAGGCGGG - Intergenic
936185259 2:110299118-110299140 CTGGGGAGCCCGCTGGAGGCGGG + Intergenic
936262463 2:110973653-110973675 GAGTGGACACAGCTGGAGGTGGG + Intronic
936760103 2:115767673-115767695 ATGGGGTCACAGTTGTAGGTGGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
940737223 2:157467080-157467102 ATGGTGAGGCAGCTGGAGGTGGG + Intronic
944478528 2:200131026-200131048 GTGGGGACACATGTGGGGGTTGG + Intergenic
944518010 2:200531765-200531787 CTGGGAATACACCTTGAGGTGGG - Intronic
945416493 2:209579357-209579379 CTGGGGACACACTTGGATGGAGG + Intronic
945781448 2:214178453-214178475 CTGAGGAAACATCTGGATGTGGG + Intronic
946023994 2:216660833-216660855 GTGGGGTCTCAGCTGGAGGAGGG + Intronic
946832382 2:223739923-223739945 TTAGGGACACAGCTGGATGTGGG + Intergenic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948378030 2:237534917-237534939 CAGGGGACATAACTGGAGATGGG + Intronic
948524845 2:238565096-238565118 GTGAGGACACAGCGGGAGGATGG + Intergenic
1169020688 20:2328611-2328633 ACAGGGACACAGCTGGAGATGGG - Intronic
1169200677 20:3707753-3707775 ATGGGGACAGAGCTGGGGGCAGG - Intergenic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169594577 20:7183291-7183313 GTGAGGACACAGCTAGAAGTTGG + Intergenic
1169916290 20:10686944-10686966 CTGGGGGCAGAGCTGGGGGCGGG - Intergenic
1170555145 20:17508941-17508963 CTGCGGAGTCAGCTGGAGGAGGG - Exonic
1171146401 20:22787540-22787562 CTGGTGTCACTGCTGGAGGCAGG - Intergenic
1172268735 20:33640153-33640175 CTGGGTACGGAGATGGAGGTGGG - Intronic
1172590114 20:36111917-36111939 CTGAGGAGGCATCTGGAGGTTGG + Intronic
1174121877 20:48271957-48271979 CAGGGGAAACAGCTTGAGATTGG - Intergenic
1174183312 20:48688602-48688624 CTGGGCTCTCAGCTGGAGGTGGG - Intronic
1174403278 20:50287771-50287793 CTGAGGCCACAGGTGGTGGTGGG - Intergenic
1175201029 20:57277773-57277795 CAGGGGCCCCAGCTGGAAGTTGG - Intergenic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175259753 20:57667097-57667119 CCAAAGACACAGCTGGAGGTGGG - Intronic
1175418322 20:58816093-58816115 CTTGAGACATAGCTTGAGGTGGG - Intergenic
1175857926 20:62132766-62132788 CTGGGTGCACAGTTGGATGTGGG + Intronic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176052537 20:63127874-63127896 ATGGGGACAGAGCTGTAGTTTGG - Intergenic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176263334 20:64194750-64194772 CTGGGGGCAAAGGTGGAAGTTGG + Intronic
1178141333 21:29686946-29686968 CTGGGGTCACCTCTGGATGTGGG + Intronic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1179359848 21:40695486-40695508 CTTGGGACTGACCTGGAGGTTGG - Intronic
1179485379 21:41706714-41706736 CAGGGGAGGGAGCTGGAGGTGGG - Intergenic
1179721134 21:43316535-43316557 CTGGGGACTCAGCTGGACTCAGG - Intergenic
1180033503 21:45229013-45229035 CTGAGGGCATAGCGGGAGGTGGG - Intergenic
1180049919 21:45326392-45326414 CGAGGGCCACAGCTGGAGGAGGG - Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180100282 21:45580778-45580800 CTGCGGTCACAGCTGCAGGGCGG - Intergenic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181140004 22:20797403-20797425 CTGGGGACACTCCTGGAGAAAGG + Intronic
1181349491 22:22244923-22244945 CTGGTGACACAGATGCATGTGGG - Intronic
1181515084 22:23405582-23405604 CTGGGGACAGAGGTGGGCGTGGG - Intergenic
1181893304 22:26083975-26083997 CTAGGGACAGAGATGGAGGCAGG + Intergenic
1182026305 22:27121912-27121934 GTGGGCACAGTGCTGGAGGTAGG - Intergenic
1183005704 22:34899962-34899984 CTGGGGGATCAGCTGGAGTTTGG + Intergenic
1183341917 22:37286298-37286320 AAGGTGACACAGCTGGAGGGTGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1184799995 22:46753299-46753321 CTGGGGACACTGCAAGGGGTGGG - Intergenic
1184866518 22:47204611-47204633 CAGGGGACAAAGCTGCAGGGCGG - Intergenic
949895701 3:8766423-8766445 CTGAGGACAAGGCTGAAGGTGGG - Intronic
950289414 3:11771381-11771403 GTGGGGAGGCTGCTGGAGGTTGG + Intergenic
950445943 3:13038505-13038527 CGGGGGACAGAGGGGGAGGTAGG + Intronic
950552573 3:13675569-13675591 CTGCTGGCAGAGCTGGAGGTGGG - Intergenic
952922819 3:38298155-38298177 CTGGGGACACACCTTCAGTTTGG + Intronic
953741799 3:45544938-45544960 CTGGAGACAAAGCTAAAGGTAGG + Intronic
954205207 3:49053712-49053734 ATGGGGCCACAGATGGCGGTTGG + Intronic
954375566 3:50192522-50192544 CTGGTCAACCAGCTGGAGGTGGG + Intronic
954575957 3:51676349-51676371 CTGGGGTCAGTGCTGGAGGCTGG + Intronic
954636378 3:52073109-52073131 CTGAGGGCAGAGCTGGGGGTGGG - Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
956603496 3:71048806-71048828 GGGGGGGTACAGCTGGAGGTGGG + Intronic
957153939 3:76522352-76522374 ATGGGCACACAGTTGGAGTTGGG - Intronic
957165259 3:76664110-76664132 CTGAGGACACAGCTAGAATTAGG + Intronic
957188423 3:76973900-76973922 ATGGGGACACAGGTGGGGATGGG + Intronic
957656903 3:83091801-83091823 CTAGGGTCAAAGCTAGAGGTTGG - Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
959981653 3:112524355-112524377 GTGGTGACACAGCTGAAGTTAGG + Intergenic
960425280 3:117499411-117499433 CTGAGTACACAGCTGAATGTGGG + Intergenic
960707396 3:120494109-120494131 GTGGGGACACACCTGAAGTTGGG + Intergenic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961506642 3:127374741-127374763 CTGGGGACACAGCAGGTCCTGGG - Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962342737 3:134598757-134598779 CTGGGGACCCAGGAGGAGTTGGG + Intronic
962412351 3:135152381-135152403 CTGGGGGTACAGCAGGAGCTTGG + Intronic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966871024 3:184290720-184290742 CTGGGAGCAGGGCTGGAGGTGGG + Intronic
967863496 3:194171299-194171321 GTGAGGACACATCTGTAGGTAGG - Intergenic
968502137 4:955732-955754 CTGGGGACACGCCAGGAGGGTGG - Intronic
968945529 4:3661573-3661595 CTGAGGACAAGGCTGGTGGTGGG - Intergenic
969406006 4:6992208-6992230 CCGAGGTCACAGCTGGTGGTTGG + Intronic
969409824 4:7020539-7020561 ATGGGGACACAGCTAGAAATTGG + Intronic
969538089 4:7768950-7768972 CTGGTGTCACAGCTGGAGATGGG + Exonic
969662154 4:8536638-8536660 CTGGGGACTGTGCTGGATGTGGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
972629127 4:40828439-40828461 CTGGGCACAGATCTGGAGATAGG - Intronic
973533551 4:51857547-51857569 CTGGGAGCACAGCTTGATGTGGG + Intronic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
976361270 4:84181534-84181556 CTGGGTAGACAACTGGGGGTTGG - Intergenic
977263251 4:94823427-94823449 CTGGGGGCAAAGCTGGTGTTCGG + Intronic
981162767 4:141518690-141518712 CTGGGGACACAGCTTCTGGCAGG - Intergenic
981548496 4:145918707-145918729 CTGGGGTGAGAGCTGGGGGTGGG - Intronic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
985379475 4:189377201-189377223 CTGGATGCTCAGCTGGAGGTAGG + Intergenic
985493760 5:193365-193387 CTGGGGAAGCACCTAGAGGTGGG + Intronic
985494465 5:196711-196733 GTGGGGACACACCTGGAGTGGGG - Intergenic
985494483 5:196753-196775 GTGGGGACACACCTGGAGTGGGG - Intergenic
985629376 5:1006814-1006836 CTGGGAGGACAGGTGGAGGTGGG - Intergenic
986507559 5:8468359-8468381 CTTGGGTCAAAGCTTGAGGTGGG - Intergenic
987017854 5:13838329-13838351 CGGGCCACACAGCAGGAGGTGGG + Intronic
987398463 5:17449140-17449162 GTGGGGAGAGAGGTGGAGGTTGG - Intergenic
987888381 5:23842073-23842095 TTGGGGACACAGGTGGTGCTTGG + Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
990780171 5:59351946-59351968 CTGGTGAGGAAGCTGGAGGTGGG + Intronic
992137113 5:73758050-73758072 CTGGGAACACAAGTGGAGGGAGG - Intronic
993872371 5:93267850-93267872 CTGGGCACCCAGCTGCTGGTGGG + Intergenic
996115040 5:119608975-119608997 CTGGGGACTCCACTGGGGGTGGG - Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
1000151307 5:158503895-158503917 CAGGGGAGAGAGCTGGAGGTAGG + Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1002059147 5:176616159-176616181 GTGGGCACACAGTAGGAGGTAGG + Intergenic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1002965934 6:1966592-1966614 GTGATGACACAGCTGGAGGGTGG - Intronic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1006179509 6:32146144-32146166 CTGGGCAAATACCTGGAGGTGGG + Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007260237 6:40558311-40558333 CTGGGCACAAAGCTGCAGGCAGG - Intronic
1007401690 6:41606143-41606165 CTGGGGACCAAGCTGGGGCTTGG + Intergenic
1007401881 6:41607415-41607437 CTGGGCCCACATCTGGTGGTGGG + Intergenic
1007649840 6:43412649-43412671 CTGGGTCCACAGCTGGGGTTGGG - Intergenic
1008543619 6:52566630-52566652 GTGGGGACAAGGGTGGAGGTGGG - Intronic
1011025536 6:82865066-82865088 CTGTGGACAAACCTGGAAGTGGG + Intergenic
1011696932 6:89921359-89921381 CTGGGCACACTGCTTGAGGGAGG + Intergenic
1014911800 6:127103804-127103826 GTGGGGGCAGAGGTGGAGGTGGG - Intergenic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1016395112 6:143616148-143616170 TTGGGGAGATAGCTGGATGTTGG - Intronic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1017477827 6:154816202-154816224 GTGGAGACACAGCTGGACTTAGG + Intronic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1018754529 6:166837632-166837654 ATGAGGACACAGCTGGGTGTGGG - Intronic
1018859376 6:167699529-167699551 CTGGGGACAAAGCTGGCCCTGGG + Intergenic
1018916258 6:168134374-168134396 GTGGGGACACAGCTGCACATTGG - Intergenic
1019102186 6:169640601-169640623 CTGCGGACACCGCTGGTGTTCGG - Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019377259 7:699434-699456 CAGAGGTCACAGCTGGAGGAAGG + Intronic
1019436599 7:1025429-1025451 GGGGGGACACTGCTGGCGGTGGG + Intronic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1020262057 7:6536261-6536283 CTGGGGAGGCTGCTGGAGGAAGG - Intronic
1021742081 7:23696970-23696992 CAGGGGGCAGAGCTGGAGGTGGG + Intronic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022335217 7:29415572-29415594 CTCGGGACACAGTTGGTGGAGGG + Intronic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1023022511 7:36022831-36022853 GTGGGGAGAGAGATGGAGGTGGG + Intergenic
1023024482 7:36038402-36038424 CTGGGTCCACTGCTGGAGGCAGG - Intergenic
1023519045 7:41032599-41032621 CTGATGACACATCTGAAGGTAGG - Intergenic
1023562634 7:41491658-41491680 CTGGGGAGACAGCAGTGGGTAGG - Intergenic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1023859976 7:44212749-44212771 CTGGGGCCACTGTTGGGGGTGGG + Exonic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024455201 7:49598004-49598026 CTGGAGACGAAGCTGGAAGTGGG + Intergenic
1024672985 7:51613462-51613484 CTGGGGTCAAAGTTAGAGGTGGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1029270598 7:99374815-99374837 CAGGGGAGCCACCTGGAGGTGGG + Intronic
1029504186 7:100952200-100952222 GTGGTCACACAGATGGAGGTGGG - Exonic
1031007827 7:116494817-116494839 GTGGGGGGACAGTTGGAGGTGGG + Intronic
1032080305 7:128855304-128855326 CTGGGCACAAACCTGGAGGCTGG - Exonic
1032197466 7:129797625-129797647 CTGGGGAAAAAGCTGGGGGCGGG + Intergenic
1032417161 7:131744635-131744657 CTGTGGAGACTGCTGAAGGTTGG - Intergenic
1033501043 7:141950062-141950084 CTGAGGAGAAAGCAGGAGGTGGG - Intronic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1034707505 7:153158663-153158685 CTAGGGACAGAGATGGGGGTTGG + Intergenic
1035023941 7:155814629-155814651 TTGTGGGCACAGCTGGACGTGGG + Intergenic
1035353844 7:158265457-158265479 GACGGGACACACCTGGAGGTAGG + Intronic
1036208328 8:6821652-6821674 GCAGGGCCACAGCTGGAGGTTGG + Intronic
1036690118 8:10939929-10939951 CAGGGGACACACCTGGGGGAGGG - Intronic
1037818422 8:22124075-22124097 CTGGGGGCAGAGCTGGGTGTGGG - Intronic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038726130 8:30083970-30083992 CTGGGGACACAACTTCAGGGAGG + Intergenic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1039588916 8:38730228-38730250 CTAGGGAACCCGCTGGAGGTGGG + Intronic
1039613645 8:38938135-38938157 ACTGGGACACAGCTGGGGGTGGG - Intronic
1041106896 8:54453549-54453571 CCGGGGCCACAGTTGGAGGTGGG + Intergenic
1043534983 8:81192986-81193008 CTGGGGACTCGGGGGGAGGTTGG - Intergenic
1044658691 8:94574327-94574349 CTGGGGAGTCAACTGGAGGCTGG + Intergenic
1044853176 8:96448828-96448850 CTCAGGCCACATCTGGAGGTGGG - Intergenic
1045086087 8:98687466-98687488 CGGGTCACACAGCTGGAGGTGGG - Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049178635 8:141209041-141209063 CTGAGGACGCAGCTGGAGTTGGG - Intronic
1049229796 8:141476000-141476022 CACGGGCCACAGCTGGATGTTGG + Intergenic
1049276181 8:141721189-141721211 GTGTGGACACAGCTGGGGGGAGG - Intergenic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1050646324 9:7723604-7723626 TTGGGGAAACATCTTGAGGTGGG + Intergenic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1053006877 9:34610839-34610861 CGAGGGCCACAGCTGGAGCTGGG + Exonic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053826563 9:42030700-42030722 CAGGAGAGACAGCTGCAGGTGGG - Intronic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054603997 9:67156697-67156719 CAGGAGAGACAGCTGCAGGTGGG + Intergenic
1055416619 9:76091095-76091117 CCGGCCACACAGCAGGAGGTGGG - Intronic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1057914910 9:99048011-99048033 CTGGGGATGGAGCCGGAGGTTGG + Intronic
1059352709 9:113676940-113676962 CTGGGGGGGCAGGTGGAGGTGGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060018968 9:120112011-120112033 CTGGGGACTCTGCTCTAGGTTGG - Intergenic
1060209284 9:121700047-121700069 CTGGGGGCACAGCCTGAGGCTGG + Intronic
1061103209 9:128508292-128508314 CTGGGGAGACTGGTTGAGGTGGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1061816341 9:133199699-133199721 CTGGGAACGCAGCTGCAGCTGGG - Intergenic
1061826074 9:133258993-133259015 ATGGGGACAGAGCTTCAGGTTGG + Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1061997199 9:134192574-134192596 TGGGGGACACAGCGGGAGGTGGG + Intergenic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062305187 9:135902013-135902035 CTGTGGACACAGCAGTAAGTGGG + Intronic
1062376745 9:136265266-136265288 CTGGGGGCACATGTGGAGGGGGG - Intergenic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187505854 X:19877883-19877905 GTGGGGGCACTGCTGGAGGCTGG - Intronic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1190919690 X:54840148-54840170 CTGGGGGCAGAGGTGGAGGGTGG + Intergenic
1196562323 X:117164923-117164945 ATGGGGGTACAGCAGGAGGTTGG + Intergenic
1198530548 X:137547018-137547040 CTGGGGACAGAGGAGGTGGTAGG + Intergenic
1200079113 X:153566794-153566816 CAGGGGACGCAGCGGGAGTTGGG - Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic