ID: 1132942878

View in Genome Browser
Species Human (GRCh38)
Location 16:2516976-2516998
Sequence CCTTTTCTACAGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132942878_1132942891 22 Left 1132942878 16:2516976-2516998 CCTGCTGCCCTCTGTAGAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 177
Right 1132942891 16:2517021-2517043 GGTGGACTACTGGCCTCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 104
1132942878_1132942887 12 Left 1132942878 16:2516976-2516998 CCTGCTGCCCTCTGTAGAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 177
Right 1132942887 16:2517011-2517033 TCCTGCCTCTGGTGGACTACTGG 0: 1
1: 0
2: 1
3: 23
4: 169
1132942878_1132942885 1 Left 1132942878 16:2516976-2516998 CCTGCTGCCCTCTGTAGAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 177
Right 1132942885 16:2517000-2517022 CCTGGCTCACTTCCTGCCTCTGG 0: 1
1: 0
2: 3
3: 59
4: 414
1132942878_1132942890 21 Left 1132942878 16:2516976-2516998 CCTGCTGCCCTCTGTAGAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 177
Right 1132942890 16:2517020-2517042 TGGTGGACTACTGGCCTCACAGG 0: 1
1: 0
2: 0
3: 21
4: 143
1132942878_1132942886 4 Left 1132942878 16:2516976-2516998 CCTGCTGCCCTCTGTAGAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 177
Right 1132942886 16:2517003-2517025 GGCTCACTTCCTGCCTCTGGTGG 0: 1
1: 0
2: 3
3: 32
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132942878 Original CRISPR CCTTTTCTACAGAGGGCAGC AGG (reversed) Intronic
900640224 1:3684943-3684965 CCTTGTCCCCAGAGAGCAGCCGG - Intronic
900688487 1:3964938-3964960 CCTTGTTTAAAGATGGCAGCAGG - Intergenic
900763478 1:4488329-4488351 CCTCTACAGCAGAGGGCAGCTGG - Intergenic
901415530 1:9113532-9113554 CCTTCCCTACAGAGGCCAGTGGG - Intronic
902652480 1:17845558-17845580 CCCTTTTTACAGCAGGCAGCAGG - Intergenic
902944562 1:19825484-19825506 CCTCTGCTGGAGAGGGCAGCAGG - Intergenic
903836669 1:26207918-26207940 GCCTTTCTAGAGAGAGCAGCTGG + Intergenic
903936745 1:26900598-26900620 CCTTTCCCACAGAGGGAAGCCGG + Intronic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
905028170 1:34865407-34865429 CCTCTTCTGGAGAGAGCAGCTGG + Intergenic
905033455 1:34902667-34902689 CATTCTCTACAGAGAGCAGCAGG + Intronic
905690846 1:39941497-39941519 CCTTTTCTCCAGAAGTCAGGTGG + Intergenic
906053558 1:42895503-42895525 CCTTTTCAACACATGGCACCAGG - Intergenic
914863410 1:151405494-151405516 GGTTTTCTACAGAGGGCAGATGG - Exonic
915635181 1:157181474-157181496 CCTTTTCAGGAGAGGGCAGTTGG + Intergenic
915885804 1:159719342-159719364 CATTTTCTTCACAAGGCAGCAGG - Intergenic
917923606 1:179771040-179771062 CCCTGTCAGCAGAGGGCAGCAGG - Intronic
918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG + Intronic
919536603 1:198796081-198796103 CATTTTCTTCACAAGGCAGCAGG + Intergenic
921189026 1:212693580-212693602 CCATTTCTGAAAAGGGCAGCTGG + Intronic
1064964475 10:21001080-21001102 CCTTCTCCACAGAAAGCAGCAGG + Intronic
1066035382 10:31476526-31476548 CCTTATCTACAAAGGAGAGCAGG + Intronic
1069638063 10:69937623-69937645 CCTTTCCTCCAGGGGGAAGCAGG + Exonic
1071462825 10:85914573-85914595 CCATGTCCACAGAGGGCAGCTGG - Intronic
1074324246 10:112432465-112432487 TCCTTTATTCAGAGGGCAGCAGG + Exonic
1075239522 10:120765306-120765328 CCTCTTCTATAGATGGCAGCTGG + Intergenic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1079296541 11:19240480-19240502 CCTTTTCTACAGATGGGAGAGGG - Intronic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1081851251 11:46276702-46276724 CCTTTCACACAGAGGGAAGCTGG + Intergenic
1083923823 11:65794170-65794192 CCATGTCTTCAGAGGGCAGCTGG - Exonic
1084672348 11:70614811-70614833 CCTTCTCAACACAGGGCTGCAGG + Intronic
1085865225 11:80282832-80282854 CCTTATCAACAGAGGGCAGCAGG - Intergenic
1087474743 11:98621360-98621382 TGTCTTCTACAGATGGCAGCAGG - Intergenic
1088830680 11:113533607-113533629 CCTTTTCTCCAAAGGGCAGAGGG - Intergenic
1089564359 11:119363285-119363307 CCATTTATGCAGCGGGCAGCGGG - Intronic
1093692034 12:22119750-22119772 CCATTGCTACAGAGTGCTGCTGG + Intronic
1096370326 12:51063957-51063979 TCTGATTTACAGAGGGCAGCTGG + Exonic
1097585021 12:61504933-61504955 CCTTTTCTGTAGTGGGAAGCAGG - Intergenic
1099517486 12:83615394-83615416 CTTTCTGTACAGAGAGCAGCAGG + Intergenic
1102798253 12:115708306-115708328 CCATTTCTACTGAGAGGAGCCGG + Intergenic
1102967516 12:117139724-117139746 CCTTTTCCACACAGGACACCTGG - Intergenic
1104550345 12:129751073-129751095 TCTCATCTCCAGAGGGCAGCAGG - Intronic
1104892089 12:132144943-132144965 CCATCTCCTCAGAGGGCAGCTGG - Exonic
1105705157 13:22963766-22963788 TATTTTCAACAGAGAGCAGCTGG - Intergenic
1105858072 13:24388782-24388804 TATTTTCTACAGAGAGCAGCTGG - Intergenic
1106080512 13:26496778-26496800 TCTTCCCTCCAGAGGGCAGCAGG - Intergenic
1106158848 13:27182962-27182984 CCCTTTATTCAGAAGGCAGCAGG - Intergenic
1107749540 13:43549958-43549980 ATTTTTCCACAGATGGCAGCAGG + Intronic
1109370919 13:61417780-61417802 CCCTTTCCACAGAGACCAGCTGG - Intronic
1112614217 13:100986949-100986971 CCTTCCTTACAGAGGACAGCTGG + Intergenic
1113421221 13:110173045-110173067 GCTTATCTCCAGACGGCAGCAGG - Intronic
1113510253 13:110848388-110848410 CCCCTTCTTCAGAGGGCGGCAGG + Intergenic
1113782980 13:112987077-112987099 CCTTTTACACAGATGGCACCCGG + Intronic
1114646030 14:24256591-24256613 CCCTTTCTACTGGGGGGAGCTGG + Intronic
1115887255 14:37986222-37986244 CCTTTTCCCCAGAGGGCAGAGGG + Intronic
1115961313 14:38837936-38837958 CCTCTTCCACACAGGGAAGCAGG + Intergenic
1120529188 14:85611378-85611400 GCTTTTCTAGAGAGGGTTGCGGG + Intronic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1124393615 15:29281764-29281786 CCTAGTCTACAGATGTCAGCTGG - Intronic
1129610933 15:77056245-77056267 TGTTTTCTACAGGGGGCAGCTGG - Exonic
1131216691 15:90542669-90542691 CTTTTGCTACAGAGGACAGCAGG - Intronic
1132942878 16:2516976-2516998 CCTTTTCTACAGAGGGCAGCAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134447189 16:14339535-14339557 ACTTTTCTACAGAAGTTAGCTGG - Intergenic
1135147543 16:19975794-19975816 CCTTTTCTTCACAAGACAGCAGG + Intergenic
1137873107 16:51969876-51969898 TCTTTCCTAGAGAGGGCAGCCGG - Intergenic
1138216799 16:55211623-55211645 CTTTCTTAACAGAGGGCAGCTGG - Intergenic
1141322054 16:83020388-83020410 CTTTTCCCACAGAGGGCAGTGGG - Intronic
1141674196 16:85509065-85509087 TCTTCTCTACAGAGGCCACCTGG - Intergenic
1141923378 16:87151509-87151531 CCTTTTCACCAGATTGCAGCAGG + Intronic
1142328253 16:89432519-89432541 CCTTTTCTACTGTGTCCAGCTGG + Intronic
1143059674 17:4189452-4189474 TGTTTACTACAGCGGGCAGCTGG - Exonic
1144891800 17:18498621-18498643 CCTGTTTTACAGAGGGAAGGGGG - Intergenic
1145140422 17:20445696-20445718 CCTGTTTTACAGAGGGAAGGGGG + Intergenic
1148049975 17:44765152-44765174 CCATTTATCAAGAGGGCAGCGGG - Intronic
1148835584 17:50464083-50464105 CCTTTCCTACACCTGGCAGCTGG - Intronic
1150646736 17:66983321-66983343 CCTTTTCCCCAGCGTGCAGCAGG - Intronic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151551022 17:74822587-74822609 CCTTTTCTCCAGAATGCTGCTGG + Intronic
1156341910 18:36217428-36217450 TCTTTACTACTGAGGGTAGCTGG + Intronic
1157134820 18:45043937-45043959 CCCTTCCCACAGATGGCAGCTGG - Intronic
1157498005 18:48170311-48170333 CCTATTCTGCAGGGGGCATCTGG + Intronic
1158107274 18:53899880-53899902 CATTTTCTTCACAAGGCAGCAGG - Intergenic
1160070847 18:75626490-75626512 CCTTAGCTATGGAGGGCAGCTGG - Intergenic
1160507735 18:79436811-79436833 CCTTTCCTTCAGAGGGAAGGAGG + Intronic
1162565238 19:11442292-11442314 CCTCTACTCCACAGGGCAGCAGG - Intronic
1162860731 19:13504657-13504679 ATTTTTACACAGAGGGCAGCTGG + Intronic
1163852128 19:19670083-19670105 CCCGTTCTTCCGAGGGCAGCTGG - Intronic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
934861161 2:97764612-97764634 GCTCTTCCACAGAGGCCAGCTGG - Intronic
935602435 2:104936757-104936779 CCTTTTTTTCACAGGGCAGAAGG - Intergenic
936895940 2:117427730-117427752 CCTCATCTAAACAGGGCAGCTGG - Intergenic
941379689 2:164777777-164777799 CCTTTTCTCCAGCTGGCTGCAGG - Intronic
941583889 2:167332592-167332614 TCTTTACTAAAGAGGGCAACTGG - Intergenic
941909494 2:170749791-170749813 CGCTTTCTTCACAGGGCAGCAGG + Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
945552174 2:211233900-211233922 TCTCTTCTTCACAGGGCAGCAGG + Intergenic
946805662 2:223468997-223469019 CCTGCTCTGTAGAGGGCAGCTGG - Intergenic
948692232 2:239713521-239713543 CCCTGTCTACACAGGGCAGGAGG + Intergenic
948952862 2:241265814-241265836 CCCTTTCTAGAGAGGGAAGACGG - Intronic
1168977776 20:1980910-1980932 CCCATTCCTCAGAGGGCAGCAGG + Exonic
1169305918 20:4490334-4490356 CCTTTTCTGCAGAGTGAACCTGG - Intergenic
1170249079 20:14259657-14259679 CCTTTTCTTCAGGGAGCTGCTGG + Intronic
1173056862 20:39622989-39623011 CCTCTTCTTCACAGGGTAGCAGG - Intergenic
1174286606 20:49478542-49478564 CCTTTCCTTCTGAGAGCAGCAGG - Intronic
1174993639 20:55541631-55541653 CCCTGTCTTCAGAGGACAGCAGG - Intergenic
1175589076 20:60172924-60172946 CCTCTCCTCCAGTGGGCAGCAGG + Intergenic
1175972230 20:62692326-62692348 CCTGCTCTGCAGTGGGCAGCTGG - Intergenic
1179187828 21:39098183-39098205 CCTTTTCCACTGGGGCCAGCAGG + Intergenic
1180877933 22:19183768-19183790 CCGTTTCACCAGTGGGCAGCAGG - Intronic
1181388037 22:22558783-22558805 CCTTTTCTTCAGTGGGATGCGGG + Intronic
1182653896 22:31874282-31874304 CCTTCTGTTCAGAGAGCAGCTGG - Exonic
1183831495 22:40420568-40420590 CCTTTTCTTCCCAGGTCAGCAGG - Exonic
950196882 3:11015590-11015612 CAGCTCCTACAGAGGGCAGCAGG - Intronic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
950581501 3:13865307-13865329 CCTTTTCTCCCCGGGGCAGCTGG + Intronic
950668494 3:14511469-14511491 CTTTTTCTCCAGCGGCCAGCAGG - Exonic
951674426 3:25220644-25220666 CATCTTCTTCACAGGGCAGCAGG - Intronic
953610678 3:44445061-44445083 CCTTTTCTCCTGAGAGCAGCAGG + Exonic
954304049 3:49716305-49716327 CCTTCTGTAGAGAGGGCAGTGGG + Intronic
956511341 3:69996577-69996599 GCTTCTCTACAGAGGTCAACTGG + Intergenic
958538066 3:95430554-95430576 TCTTTTCTTCACAGGGCATCAGG - Intergenic
959908185 3:111733362-111733384 CCTTTGCTACAGAGGGACTCAGG - Intronic
959919378 3:111854107-111854129 CACTTTCTTCACAGGGCAGCAGG + Intronic
960164051 3:114381792-114381814 CTGTTTCTTCAGAGGGCAGGAGG + Intronic
960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG + Intronic
964605351 3:158554962-158554984 CCTTTTCTCCGGAGGACAGAGGG - Intergenic
969472147 4:7395226-7395248 CCGTTTCCACAGATGGCAGCTGG - Intronic
969475461 4:7420200-7420222 CATTTTCTACTGGGGCCAGCTGG - Intronic
970987064 4:22171171-22171193 CATCTTCTTCACAGGGCAGCAGG + Intergenic
977719258 4:100220724-100220746 CATCTTCTTCACAGGGCAGCAGG + Intergenic
978913525 4:114095401-114095423 CCTGTACTGGAGAGGGCAGCTGG - Intergenic
979848277 4:125544639-125544661 CATCTTCTTCACAGGGCAGCAGG - Intergenic
980650655 4:135711089-135711111 GCATCTCTTCAGAGGGCAGCAGG - Intergenic
987918885 5:24252142-24252164 CCTTGTCTCCACAGGGCAGAAGG + Intergenic
988225472 5:28406704-28406726 CCTTTTCTGAACAGGGGAGCGGG + Intergenic
989997478 5:50853153-50853175 CCTTTTGTACAGATAGCAACTGG + Intergenic
990143251 5:52730150-52730172 CATCTTCTTCACAGGGCAGCAGG - Intergenic
990786335 5:59424547-59424569 CATCTTCTTCACAGGGCAGCAGG + Intronic
991075968 5:62538544-62538566 CATCTTCTTCACAGGGCAGCAGG - Intronic
994853325 5:105085147-105085169 CATATTACACAGAGGGCAGCAGG - Intergenic
1001949119 5:175803809-175803831 CCTGCTCTAGAGATGGCAGCAGG - Intronic
1003760507 6:9173870-9173892 CCTTTTATAGAGACTGCAGCTGG - Intergenic
1004460246 6:15828500-15828522 CCTGGACTACAGAGGGCAGGCGG + Intergenic
1004963724 6:20822759-20822781 CACTTTCTTCAGAAGGCAGCAGG - Intronic
1005787500 6:29260881-29260903 TCTTATGTACAGAGGGCAGATGG + Intergenic
1007019264 6:38503239-38503261 TCATTTCTGCAGAAGGCAGCGGG - Intronic
1007092571 6:39193395-39193417 CCTTTTGCCCAGAGGGCAGTGGG - Intronic
1008717409 6:54305854-54305876 CCTTCTCTACTGAGGGCTGCTGG - Intergenic
1009992672 6:70863356-70863378 ACTTTTCTCCAAAAGGCAGCAGG - Intronic
1010398615 6:75422398-75422420 CCTTTTCTTCAGAGGCCAGATGG - Intronic
1010735569 6:79440287-79440309 CCCTCTCTACAGGGGGCAGAGGG - Intergenic
1012111225 6:95237539-95237561 CCTCTTATACAGAGTGGAGCAGG - Intergenic
1012621739 6:101353049-101353071 TCTTTCCTCCAGAGGGCATCAGG + Intergenic
1012779295 6:103536276-103536298 GCTTTTCTCCAGAGGGGAGAGGG - Intergenic
1013009466 6:106106523-106106545 CATTTTCTACAAAGGTCAGAAGG - Intronic
1014511515 6:122328191-122328213 CCTTTTCTCCGGAGGTGAGCTGG + Intergenic
1017586214 6:155927149-155927171 CAATTTCTAAAGAGGCCAGCTGG + Intergenic
1017628004 6:156367965-156367987 CCCTTTCTCCACAGGGCAGGTGG - Intergenic
1018190228 6:161304083-161304105 CCATTTCGCCAGCGGGCAGCTGG - Intergenic
1018251031 6:161870667-161870689 CCTTTCCTTCACAGGCCAGCAGG - Intronic
1018751142 6:166807586-166807608 CCATTCCTACAGAGGCCAGGAGG + Intronic
1022746492 7:33178157-33178179 TCGTTTCTGCACAGGGCAGCTGG + Intronic
1026834162 7:73627113-73627135 CACATCCTACAGAGGGCAGCAGG - Intergenic
1029606880 7:101604549-101604571 CCCTTGCTAAAGAGGGCAGTAGG + Intergenic
1030989380 7:116281674-116281696 CCTTGTCTACAATGGGCAGTAGG - Intergenic
1031489692 7:122371388-122371410 CATCTTCTTCACAGGGCAGCAGG + Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1033569015 7:142608412-142608434 CCTTTTCTACTGGGAGCAGGTGG + Intergenic
1035074361 7:156168753-156168775 GCTTGTCTGCAGAGGGCAGCGGG + Intergenic
1035917870 8:3644638-3644660 CCTTCAGTAAAGAGGGCAGCAGG + Intronic
1036470582 8:9049040-9049062 CCATCTTTACAAAGGGCAGCTGG + Intronic
1039046159 8:33451822-33451844 CACTTTCTTCACAGGGCAGCAGG + Intronic
1041430548 8:57776836-57776858 CACTTTCTTCACAGGGCAGCAGG - Intergenic
1042974120 8:74446101-74446123 CCTTTTCTACTTCGGGGAGCTGG + Intronic
1043370468 8:79584741-79584763 CCTTTTTTTCACAGGGCAGCAGG - Intergenic
1043570030 8:81592553-81592575 CCTATTCTGCTGTGGGCAGCAGG + Intergenic
1043700094 8:83275969-83275991 CCTTTTCACCTGAAGGCAGCAGG + Intergenic
1043800475 8:84603572-84603594 TCTTGTCTACAGTGGGCAGGAGG - Intronic
1049551274 8:143261094-143261116 CCTCTTCGACACAGGGAAGCAGG + Intronic
1051535960 9:18158090-18158112 CCATTTATACAGAGAGCAGGAGG - Intergenic
1052496275 9:29229716-29229738 TCTCTTTTACAGATGGCAGCAGG - Intergenic
1052502399 9:29308305-29308327 CATCTTCTTCACAGGGCAGCAGG + Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1055189384 9:73498751-73498773 CACTTTCTTCACAGGGCAGCAGG - Intergenic
1056179275 9:84066015-84066037 CCTGTTCTCCAAGGGGCAGCAGG + Intergenic
1056698319 9:88879375-88879397 CCTTTCCTCCAGAGGCCACCTGG + Intergenic
1060095294 9:120783580-120783602 GCCTTTCTAAAGAGTGCAGCTGG - Intronic
1060144755 9:121242437-121242459 CCCTTTTTCCAGAGGACAGCAGG - Intronic
1060169150 9:121446588-121446610 CCTTTTCTCCAGATGTCATCTGG + Intergenic
1060266791 9:122116298-122116320 CCCTTTCTACAGTGACCAGCAGG - Intergenic
1060799628 9:126535333-126535355 CATTTTCTTCTGAGGGCAGTGGG - Intergenic
1061247094 9:129406126-129406148 CCTTTTCTACTGAAAGCATCAGG - Intergenic
1061720070 9:132546037-132546059 CCTTGTCCCCAGAGGCCAGCAGG + Intronic
1188802721 X:34551482-34551504 CGTCTTCTACACAAGGCAGCAGG - Intergenic
1194786100 X:98086131-98086153 CTTCTTCTACACATGGCAGCAGG + Intergenic
1195839528 X:109157749-109157771 CCATCTCTTCACAGGGCAGCAGG + Intergenic
1197926368 X:131650764-131650786 CCCTTTCTGCAGTAGGCAGCAGG + Intergenic
1198683514 X:139205110-139205132 CTTTTACTACAGCGGGCAGGCGG - Intronic
1199338871 X:146651868-146651890 CACTTTCTTCACAGGGCAGCAGG + Intergenic