ID: 1132943094

View in Genome Browser
Species Human (GRCh38)
Location 16:2518177-2518199
Sequence CTGCCCTCCAGGGCCACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132943094_1132943098 -4 Left 1132943094 16:2518177-2518199 CCTGTGGTGGCCCTGGAGGGCAG 0: 1
1: 0
2: 1
3: 32
4: 387
Right 1132943098 16:2518196-2518218 GCAGCTGGCAGAAGTCAGAAAGG 0: 1
1: 1
2: 2
3: 51
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132943094 Original CRISPR CTGCCCTCCAGGGCCACCAC AGG (reversed) Intronic