ID: 1132945327

View in Genome Browser
Species Human (GRCh38)
Location 16:2529012-2529034
Sequence GTGCAGGGATGCAGCCTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 375}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132945327_1132945335 -1 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945335 16:2529034-2529056 CCCCGCCCAGTTGCTGGGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 309
1132945327_1132945341 12 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945341 16:2529047-2529069 CTGGGGCTGGAGAAGAGTAAGGG 0: 1
1: 0
2: 4
3: 59
4: 527
1132945327_1132945343 20 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945343 16:2529055-2529077 GGAGAAGAGTAAGGGGACCCTGG 0: 1
1: 0
2: 3
3: 22
4: 395
1132945327_1132945333 -5 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945333 16:2529030-2529052 TGCACCCCGCCCAGTTGCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 337
1132945327_1132945342 13 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945342 16:2529048-2529070 TGGGGCTGGAGAAGAGTAAGGGG 0: 1
1: 0
2: 8
3: 80
4: 571
1132945327_1132945340 11 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945340 16:2529046-2529068 GCTGGGGCTGGAGAAGAGTAAGG 0: 1
1: 0
2: 6
3: 71
4: 673
1132945327_1132945332 -6 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945332 16:2529029-2529051 CTGCACCCCGCCCAGTTGCTGGG 0: 1
1: 0
2: 0
3: 23
4: 201
1132945327_1132945344 27 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945344 16:2529062-2529084 AGTAAGGGGACCCTGGACTTTGG 0: 1
1: 0
2: 1
3: 14
4: 152
1132945327_1132945331 -7 Left 1132945327 16:2529012-2529034 CCCTGGAGGCTGCATCCCTGCAC 0: 1
1: 0
2: 1
3: 34
4: 375
Right 1132945331 16:2529028-2529050 CCTGCACCCCGCCCAGTTGCTGG 0: 1
1: 0
2: 1
3: 30
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132945327 Original CRISPR GTGCAGGGATGCAGCCTCCA GGG (reversed) Exonic
900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG + Intergenic
900479593 1:2891662-2891684 GTGCAGAGCTGCAGCCGCCAGGG - Intergenic
900761437 1:4474224-4474246 GTGTGGGGATGGAGCCTGCAGGG + Intergenic
900895320 1:5479228-5479250 ATGCACAGATGCTGCCTCCAGGG - Intergenic
901006225 1:6172863-6172885 GAGCAAGGACGCAGCCGCCAGGG + Intronic
902630339 1:17701091-17701113 GAGCCTGGATGCAGCCTCCAAGG + Intergenic
902676936 1:18015369-18015391 CTGGTGGGATGCTGCCTCCAGGG + Intergenic
903179041 1:21596373-21596395 GTGCCGGGCTGCCCCCTCCATGG + Intronic
904613271 1:31736691-31736713 GTGCAGGAAGGCAGCCGTCATGG + Exonic
907921999 1:58922517-58922539 GTGCAGGGCAAGAGCCTCCAGGG - Intergenic
909357485 1:74726240-74726262 CTGCAGGGATGGAGCCCTCATGG - Intronic
910170502 1:84372049-84372071 GTGCAGGGATGTGGACTTCAAGG - Intronic
912327805 1:108785216-108785238 CTGCAGGGATGGAGCCCTCATGG - Intronic
912447977 1:109751901-109751923 GTCCAGGGATGGAGCTGCCAAGG - Intronic
913051456 1:115120156-115120178 ATGCAGGGATGGAGCCCTCATGG - Intergenic
915058422 1:153158710-153158732 CTGCAGGGATGGAGCCCTCATGG - Intergenic
915224354 1:154401739-154401761 GTGGAGGAATGCAGCATCCCTGG - Intergenic
919811729 1:201412957-201412979 GGGCACGGATGCAGCAGCCATGG - Intronic
920324994 1:205156133-205156155 CTGCAGGGGTGGAGCCCCCATGG + Intronic
920433224 1:205932122-205932144 GTGCAGGGATCCATCCCCCTGGG - Intronic
920606999 1:207398806-207398828 AAGCAGGGATGCAGGCCCCATGG - Intergenic
920871685 1:209800194-209800216 GAGCAGAGACGTAGCCTCCAGGG + Intronic
922218863 1:223542628-223542650 GTACAGGGGTGCAGTGTCCACGG + Intronic
922931212 1:229391056-229391078 GTGCGGGCAGCCAGCCTCCAGGG - Intergenic
923021516 1:230167739-230167761 GTGCAGGGCTGCAGCCTGGCCGG + Intronic
1062918122 10:1257499-1257521 GTGCATGGAGGCAGGCTCCCAGG - Intronic
1064601589 10:16998933-16998955 GGGCAAGGATGAAGTCTCCATGG - Intronic
1067270692 10:44789167-44789189 GGGCAGGGAAGCAGATTCCATGG - Intergenic
1067966902 10:50923395-50923417 CTGCAGGGGTGGAGCCTTCATGG - Intergenic
1068128439 10:52868778-52868800 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1068305274 10:55199966-55199988 TTGCAGGGGTGGAGCCTTCATGG + Intronic
1069424517 10:68278013-68278035 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1070349928 10:75582262-75582284 CTGCAGGGATGGAGCCCTCATGG - Intronic
1070555589 10:77525401-77525423 GTGCAGGGTTGGAGACTCAATGG + Intronic
1070752445 10:78972341-78972363 GATCAGGGAGGCAGGCTCCAGGG - Intergenic
1070761323 10:79026279-79026301 GAGCAGGGATGCAGCCTGTGTGG - Intergenic
1072723482 10:97796132-97796154 GAGATGGGATGCAGCATCCAGGG - Intergenic
1073193127 10:101666458-101666480 GAGGAGGGGTGCAGGCTCCATGG + Intronic
1075562822 10:123480728-123480750 ACGCTGGGATGGAGCCTCCAGGG + Intergenic
1075664426 10:124220635-124220657 CTGCAGGGATCGAGCCTGCAGGG - Intergenic
1076202497 10:128569612-128569634 GTGGAAGAATGCAGCCTGCACGG - Intergenic
1077076061 11:702793-702815 TTCCAGGGAAACAGCCTCCATGG - Intronic
1077088901 11:769231-769253 CTGGAGGGACGCAGCCTTCAGGG + Exonic
1077296722 11:1829845-1829867 GTGATGGGGTGCAGCCTCCACGG + Intronic
1078750190 11:14154267-14154289 CTGCAGGGATGGAGCCCTCATGG - Intronic
1079644347 11:22844521-22844543 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1079819339 11:25105571-25105593 CTGCAGGGATGGAGCCCTCATGG - Intergenic
1079916209 11:26371381-26371403 CTGCAAGGATGGAGCCTTCATGG + Intronic
1079925742 11:26489384-26489406 TTGCAGGGGTGCAGCCCTCATGG + Intronic
1081594341 11:44448848-44448870 GGTCAGGGCTGCCGCCTCCAGGG + Intergenic
1082788414 11:57330465-57330487 GTGCAGGGATTCTGGCTCGAGGG - Intronic
1083148137 11:60773659-60773681 GAGCAAGGAGGCAGCCTGCAGGG + Intronic
1083174256 11:60939386-60939408 CCCCAGGGATGCAGCCCCCAGGG - Intronic
1083277235 11:61603714-61603736 TGGCAGGGATCCAGCCTCCAGGG + Intergenic
1083293063 11:61700440-61700462 GTCCAGGGCTTCCGCCTCCAGGG - Intronic
1083380792 11:62266963-62266985 CAGCAGAGATGCAGCTTCCAGGG + Intergenic
1083823250 11:65184164-65184186 GGGCAGGGCTGGGGCCTCCAAGG - Intronic
1084365289 11:68693564-68693586 GTGCAGGGGTGCGGGCCCCAGGG + Intergenic
1084471444 11:69361661-69361683 GAGCACGGCTGCAGCCTCCGGGG - Intronic
1084657586 11:70528318-70528340 CAGCAGGGATGCAGCCTCCTGGG + Intronic
1086127306 11:83361836-83361858 TTGGGGAGATGCAGCCTCCAGGG + Intergenic
1086423823 11:86664653-86664675 GAGCAGGGATGAAGTCTCCAAGG + Intronic
1087202270 11:95357714-95357736 GTCTAGGGATGTAGCCTCTATGG + Intergenic
1087255119 11:95944972-95944994 CTGCAGAGATGGAGCCTTCATGG + Intergenic
1089645460 11:119875945-119875967 GAGCAGGGAAGCAGGCTCCCAGG + Intergenic
1089735200 11:120546120-120546142 CTGTAGGGCTGCATCCTCCAAGG + Intronic
1090075203 11:123576245-123576267 AGGCTGGGATGCAGCCTGCAGGG + Intronic
1091151747 11:133335449-133335471 CTTCATGGATGCAGCCTCCAGGG - Intronic
1094311889 12:29093130-29093152 CTTCAGGGATGAAGCTTCCAGGG + Intergenic
1094450572 12:30579164-30579186 GTACAGGGATGCAGGCACTATGG + Intergenic
1095662416 12:44753004-44753026 CAGCAGGGTTGCAGCGTCCAAGG - Intronic
1095948256 12:47766179-47766201 GTGCACTGATGAAGGCTCCATGG + Intronic
1096070866 12:48774852-48774874 AAGCAGGGATGCAGGCTCCAGGG + Intronic
1096614909 12:52826742-52826764 GGGCAGGAAGGCAGCCTCCATGG - Intronic
1097046824 12:56193163-56193185 GTGAAGGGAAGAAGGCTCCATGG + Intergenic
1097136881 12:56864518-56864540 ATGCAGGGATGGAGCCCTCATGG + Intergenic
1097661447 12:62435552-62435574 TTGCAGGAGTGCAGCCACCACGG + Intergenic
1101462786 12:104913711-104913733 ATACAGGGTTGCAGCCTGCAAGG - Intronic
1101814110 12:108131855-108131877 GTGGAGGTAGGCAGTCTCCATGG + Exonic
1102734216 12:115143826-115143848 GTGCAGGGAAGCAGTGTGCAGGG - Intergenic
1103910759 12:124350761-124350783 GTCCTGGGCTGCAGCCTCCTGGG - Intronic
1104423756 12:128658002-128658024 GAGCAGGGACGCAGCTCCCATGG + Intronic
1104423765 12:128658039-128658061 GAGCAGGGACGCAGCTCCCATGG + Intronic
1104423774 12:128658076-128658098 GAGCAGGGACGCAGCTCCCATGG + Intronic
1104423783 12:128658113-128658135 GAGCAGGGACGCAGCTCCCATGG + Intronic
1104423792 12:128658150-128658172 GAGCAGGGACGCAGCTCCCATGG + Intronic
1104423801 12:128658187-128658209 GAGCAGGGACGCAGCTCCCATGG + Intronic
1104423810 12:128658224-128658246 GAGCAGGGACGCAGCTCCCATGG + Intronic
1104467095 12:128999526-128999548 GTGGAGGGGTGCAGCCTCTCCGG + Intergenic
1104727389 12:131086364-131086386 GCCCAGGAATGCAGCCTCCCAGG + Intronic
1104808039 12:131601928-131601950 GTGCAGGGGTGAGGCCTTCATGG - Intergenic
1105530292 13:21212797-21212819 GTGCAGAGATGCAGACACCAGGG + Intergenic
1105608678 13:21948584-21948606 GGGCAGGCATGCAGCCTCATGGG - Intergenic
1107343874 13:39438898-39438920 CTGCAGGGATGGAGCCCTCATGG + Intronic
1108576938 13:51799011-51799033 TTGCTGGGGTCCAGCCTCCAGGG - Intronic
1108637304 13:52348349-52348371 CTGCAGGGATGAAGGCCCCATGG - Intergenic
1108930104 13:55807294-55807316 CTGCAGGGATGGAGCCCTCATGG - Intergenic
1109171931 13:59107714-59107736 GTGCAGGGGTGGAGCCCTCAGGG + Intergenic
1110970779 13:81758398-81758420 ATGCAGGGATGGAGCCCTCATGG - Intergenic
1111382724 13:87479590-87479612 GTGTAAGTATGCAGCCTCCAAGG - Intergenic
1111419860 13:87998515-87998537 CTGCAGGGATGGAGCCATCATGG + Intergenic
1111819319 13:93194137-93194159 CTGCAGGGATGGGGCCTTCATGG + Intergenic
1112742654 13:102492672-102492694 GGGCAGGGAGGCAGGCTGCATGG + Intergenic
1115325046 14:32128589-32128611 GCCCAGGGAGGCAGCGTCCATGG - Intronic
1115600534 14:34951629-34951651 GTGCAGTGGTGCAGCTTCCTGGG + Intergenic
1116080261 14:40162585-40162607 CTGCAGGGTTGCAGCCCTCATGG + Intergenic
1116128643 14:40824291-40824313 GTACAGAAATGCAACCTCCAAGG + Intergenic
1116674020 14:47881487-47881509 ATACAGGGTTGCAGCCTGCAAGG - Intergenic
1117324312 14:54654816-54654838 GGGCAGGGATGCACCAACCATGG - Intronic
1117353939 14:54905745-54905767 GTGCAGCCATGCTTCCTCCAGGG - Intergenic
1117984544 14:61374464-61374486 CTGCAGGGATGGAGCCCTCATGG - Intronic
1118905858 14:70022711-70022733 GGCCAGGGGTGCACCCTCCAGGG + Intronic
1120270668 14:82309675-82309697 CTGCAGGGATGAAGCCCTCATGG + Intergenic
1121504330 14:94464893-94464915 GAGCAGAGATGCAGACACCATGG - Intronic
1121618754 14:95331842-95331864 GGGCAGGCCTGCAGCCTCCCAGG - Intergenic
1122120513 14:99550988-99551010 GTGCAGGCATGCACACTGCAAGG + Intronic
1122412865 14:101534856-101534878 CAGCAGGGAGGCAGCCACCATGG + Intergenic
1122886724 14:104713560-104713582 GGGCAGCAAGGCAGCCTCCATGG + Exonic
1122909994 14:104822911-104822933 TTGCAGGGATGGATCCTCAAAGG - Intergenic
1125230794 15:37452968-37452990 CTGCAGGGGTGAAGCCTTCATGG + Intergenic
1126680664 15:51199041-51199063 CTGCTGGGAGGCGGCCTCCAGGG + Intergenic
1127662692 15:61115111-61115133 CTGCAGGGATCCAGCACCCACGG + Intronic
1132571964 16:648079-648101 GGGCAGTGATGCTGCCTCCCAGG - Intronic
1132598458 16:763637-763659 GTCCAGGGGCGCAGCCTCCTGGG - Exonic
1132810561 16:1794737-1794759 GTGCAGGGAAGCAGCCGGAAGGG + Intronic
1132945327 16:2529012-2529034 GTGCAGGGATGCAGCCTCCAGGG - Exonic
1134110863 16:11514682-11514704 ACGCAGGGATGCAGCCCTCAGGG - Intronic
1134903981 16:17963554-17963576 CTGCAGGGATCCAGGCTGCAGGG + Intergenic
1135079464 16:19421874-19421896 GTGCAGTGATGCAACCTCCTAGG - Intronic
1137294943 16:47083165-47083187 GTGTACGTACGCAGCCTCCAGGG - Exonic
1137526243 16:49238994-49239016 GGGGAGGGATCCAGCCTCAAAGG - Intergenic
1138340322 16:56284960-56284982 GAGCAGGCACTCAGCCTCCAGGG + Intronic
1138800099 16:60016618-60016640 CTGCAGGGGTGGAGCCTTCATGG - Intergenic
1141697726 16:85628051-85628073 GTGAATGGACACAGCCTCCAGGG - Intronic
1141697792 16:85628328-85628350 GGGCAGGGATGCTGCCCGCAGGG + Intronic
1142004271 16:87681839-87681861 GTGCTGGGATGCAGTGTCCTGGG + Intronic
1142032071 16:87843620-87843642 GTACAGGGGTGCTGCCCCCAGGG - Intronic
1142161016 16:88557623-88557645 GGGCAGGGCTGCAGGCTGCAGGG - Intergenic
1142762278 17:2049781-2049803 GCGCAGGGAGGCGGCCTCCCGGG - Intergenic
1143140961 17:4741576-4741598 GTGCAGGGGGGCAGCCTCTGGGG - Exonic
1143341249 17:6213062-6213084 GAGCAGAGAGGCATCCTCCAGGG - Intergenic
1144499253 17:15771002-15771024 GCCCATCGATGCAGCCTCCAGGG + Intergenic
1144756884 17:17685314-17685336 GTGCAGGGATGCTTCCTGCTTGG - Intronic
1145058151 17:19716501-19716523 GGGCAGGGCAGCAGCCCCCATGG + Exonic
1145162644 17:20586035-20586057 GCCCATCGATGCAGCCTCCAGGG + Intergenic
1145276699 17:21435698-21435720 GTCAAGTGATGCAGCCTCCCGGG - Intergenic
1145314537 17:21721588-21721610 GTCAAGCGATGCAGCCTCCTGGG - Intergenic
1146098374 17:29954588-29954610 CTGCAGGGATGGAGCCCTCATGG + Intronic
1146923691 17:36730051-36730073 GTGCATGGCTGCAGCCATCAGGG + Intergenic
1147169182 17:38608186-38608208 GTTCTGTGATGCAGCCCCCAGGG + Intergenic
1147647136 17:42040590-42040612 GGCAAGGGCTGCAGCCTCCAGGG + Intronic
1148534886 17:48430551-48430573 GTGCAGGGAGGCAGAATCCAAGG + Intergenic
1148565297 17:48629110-48629132 GAGCTGGGATGCAGACTACAGGG - Intronic
1148814220 17:50315034-50315056 GTGCAGTGGTGCAACCTCCCAGG + Intergenic
1149163909 17:53726930-53726952 CTGCAGGGGTGGAGCCTTCATGG - Intergenic
1149369423 17:55978390-55978412 CTGCAGGGATGGAGCCCTCATGG - Intergenic
1149559187 17:57596024-57596046 ATGCAGGGTTGCACCCTCCTTGG - Intronic
1151412388 17:73939916-73939938 TTGGAGGGTTGCAGCCTCCCAGG + Intergenic
1152210432 17:79000410-79000432 GTGGAGGGAGGCAGCCGGCATGG - Intronic
1152236706 17:79142784-79142806 GGGCAGGGACACAGCCCCCAAGG + Intronic
1152400878 17:80065470-80065492 GTGCAGGCCTGCAGCCAACAGGG - Exonic
1152413435 17:80143238-80143260 GGGGAGGGGTGCAGCCTCCAAGG - Intronic
1154490720 18:14919951-14919973 GTGCAGGAAAGCAGCCTCTTGGG - Intergenic
1156077710 18:33301070-33301092 GAGCAGGGAAGCAGCATCCCAGG - Intronic
1156122661 18:33863836-33863858 CTGCAGGGATGGAGCCCTCATGG - Intronic
1156371099 18:36471808-36471830 TTTCAGGGAAGCAGCTTCCAGGG + Intronic
1157563242 18:48663350-48663372 GTGAAGGAAGGCAGCCTCCATGG + Intronic
1157569105 18:48700467-48700489 GTGCCGGGGGGAAGCCTCCAAGG - Intronic
1158791421 18:60784654-60784676 CTGCAGGGATGGAGCCATCATGG + Intergenic
1159319628 18:66830352-66830374 GTGCAGGGGTGGAGCCTTCATGG - Intergenic
1160987488 19:1845892-1845914 GGGCAGGGCTGGAGCCTCCAGGG - Intronic
1161021819 19:2014580-2014602 GTCCAGGGATGGAGCGTCCTGGG + Intronic
1161725361 19:5925367-5925389 GGGCTGGGCTGTAGCCTCCATGG + Intronic
1162019202 19:7861019-7861041 GTGTAGGGAGGCAGCCACAATGG - Intronic
1163267840 19:16232394-16232416 ATGCAGGGAAGCAGACGCCAGGG - Intronic
1163754573 19:19098999-19099021 GTGCAGGGAGGCACTCTCCATGG + Intronic
1165145464 19:33727332-33727354 GGGCAGTGCTGCAGCCACCACGG - Intronic
1165422472 19:35729055-35729077 ATACGGGGATGCAGACTCCAAGG + Exonic
1166773361 19:45297870-45297892 GGGCAGGGGTGCAGCCTCATGGG - Exonic
1167419513 19:49394824-49394846 GGGGAGGGAGGCAGCCACCATGG + Intronic
925001200 2:404081-404103 CTGCAGGGATGGAGCCCTCATGG - Intergenic
925013881 2:507109-507131 AGGGACGGATGCAGCCTCCAGGG + Intergenic
925267278 2:2574883-2574905 GTGCAGGGATGCAGACAGGATGG - Intergenic
926114582 2:10204362-10204384 GAGCAGGGAAGGAGACTCCAGGG + Intronic
926133765 2:10322450-10322472 GTGCAAGGATGCTTCCACCAAGG + Intronic
927102505 2:19798928-19798950 TTGCATGGATGGAGCTTCCAGGG - Intergenic
927383631 2:22507561-22507583 ATTCAGGGATGTAGCCTCCAGGG - Intergenic
927400742 2:22707272-22707294 ATGCAGGGGTGAAGCCTTCATGG - Intergenic
932613695 2:73218606-73218628 GAACAGGGAGGCAGCCACCATGG - Intronic
933708124 2:85306391-85306413 ATGCAGGGACGCTGCCTCCCTGG - Intronic
935425781 2:102917089-102917111 CTGCAGGGGTGGAGCCCCCATGG - Intergenic
936514574 2:113173769-113173791 GTGCAGGGTGGGGGCCTCCAAGG + Intronic
937363039 2:121242323-121242345 GTGCGGGGACAGAGCCTCCAAGG - Intronic
937806483 2:126151163-126151185 CTGCAGGGGTGGAGCCTTCATGG - Intergenic
940296390 2:152129639-152129661 GTGCACGGATGCAGAACCCATGG - Intronic
940829519 2:158452757-158452779 GTGCAGGGCTGCCTCCTTCAAGG + Intronic
941761140 2:169244876-169244898 GTGCAGGAATGCACTCCCCATGG + Exonic
942380528 2:175386124-175386146 CTGCAGGGATGGAGCCCTCATGG + Intergenic
942424554 2:175846007-175846029 TTGCAGGTATGGTGCCTCCATGG - Intergenic
942470088 2:176251018-176251040 GTGGAGGAATGCAGCACCCAGGG - Intergenic
942674609 2:178413721-178413743 GGGCAGGGATACAGCCGCCCGGG + Intergenic
943190874 2:184679378-184679400 GACCAGGGATGCATGCTCCATGG + Intronic
943297870 2:186161119-186161141 CTGCAGGGATGGAGCCCTCATGG + Intergenic
944538127 2:200731172-200731194 TGGCAGGGATGCAGCCTACCTGG - Intergenic
945177089 2:207053648-207053670 TTGCAAGCATGCAGCCTGCAGGG - Intergenic
947073917 2:226320461-226320483 AAGCAGGGTTGCAGCTTCCAGGG - Intergenic
947352224 2:229258073-229258095 GTGCCTGGCTCCAGCCTCCATGG - Intronic
947978405 2:234387185-234387207 GTGCAAGGATGCTGCTGCCAGGG + Intergenic
948704274 2:239779387-239779409 GGGCAGGGGTGCTGCCTCCTGGG - Intronic
948866344 2:240776741-240776763 GTCCTGGGGTGCAGGCTCCAGGG - Intronic
948887262 2:240890503-240890525 GCCCAGGGCGGCAGCCTCCAGGG + Intronic
1169309211 20:4521242-4521264 GGCCAGGGCTGCAGGCTCCACGG + Intergenic
1172061491 20:32190080-32190102 GCGCGGGGAAGCGGCCTCCACGG - Intergenic
1172095281 20:32457363-32457385 GTGCAGGTGTGGAGCCGCCAGGG - Intronic
1173808718 20:45943091-45943113 CTGCAGGCATTGAGCCTCCACGG + Exonic
1173914100 20:46693755-46693777 GTGCAGTGATGCAACCTGCTGGG + Intergenic
1174055615 20:47796215-47796237 GAGCAGGGAGCCAGCCTCCCCGG + Intergenic
1175787387 20:61720493-61720515 GTGCAGGGATGCAGAGTGGAGGG + Intronic
1175787403 20:61720553-61720575 GTGCAGGGGTGCAGAGTACAGGG + Intronic
1175787412 20:61720596-61720618 GTGCAGGGGTGCAGCATGCAGGG + Intronic
1175948963 20:62572286-62572308 CTGCAGGGATGCAGCCTGAGTGG - Intergenic
1176126745 20:63478932-63478954 GGGCACAGATGCAGCCTGCATGG - Intergenic
1176162401 20:63654350-63654372 TTGCAGGGATGAAGCCACCGAGG + Intergenic
1176277719 20:64282482-64282504 GTAAAGGGTTGCAGCCTGCAGGG + Intronic
1176822025 21:13666249-13666271 GGGCAGGGAAGCAGCATCCTGGG + Intergenic
1177557969 21:22716023-22716045 ATGAAGGGCTGCAGCCTGCAGGG - Intergenic
1178728099 21:35073102-35073124 CTGCAGAGCTGCAGCCTCCGTGG - Intronic
1180060155 21:45380921-45380943 CTGCCTGGATGCCGCCTCCACGG - Intergenic
1182897904 22:33873896-33873918 GAGAAGGGATGCAGCCTCAGTGG - Intronic
1183366756 22:37410980-37411002 GAGCAGGGAGGCAGGCTTCAGGG - Intronic
1183429134 22:37755276-37755298 GTGAAGGGATCCAGTCTCCATGG - Intronic
1183619818 22:38965872-38965894 GTGCAGGGCTGCTGTCCCCAGGG - Intronic
1184302750 22:43572063-43572085 GTGCAGGGATGCGTGCTGCAGGG + Intronic
1184477715 22:44730377-44730399 GTCCAGGGATGCACAGTCCAAGG - Intronic
1184853589 22:47134830-47134852 CAGCAGGGAGACAGCCTCCAGGG + Intronic
1185181273 22:49364733-49364755 GGGCAGGGCTGCATCCCCCAGGG - Intergenic
949407519 3:3730416-3730438 TTGCAGAGATGCAACCTGCATGG - Intronic
950138293 3:10598621-10598643 GTGCAGGGATGAAAGCTCAAAGG - Intronic
950138560 3:10600119-10600141 GTGCAGGGGTGTGGCCCCCATGG - Intronic
951850835 3:27138250-27138272 GTGCTGGGTAGCACCCTCCATGG - Intronic
951988359 3:28646686-28646708 GAGCAGTGCTGCAGCCTCCAAGG + Intergenic
952029125 3:29119978-29120000 CTGCAGGGATGAAGCCCTCATGG + Intergenic
952377588 3:32780563-32780585 GGGCAGAAATGCAGGCTCCAGGG + Intergenic
954665166 3:52247737-52247759 CTGCAGGGACACAGCCACCAGGG - Exonic
954969719 3:54641114-54641136 GTCCTGGGGTGCAGCCTCAAGGG + Intronic
955984096 3:64555430-64555452 GCCCCGGGAGGCAGCCTCCATGG + Intronic
957300923 3:78390404-78390426 CTGCAGGGGTGCAGCCCTCATGG + Intergenic
958914454 3:100033257-100033279 GTTCAAGGATGCAGCCTGCCTGG - Intronic
960224948 3:115158003-115158025 CTGCAGGGGTGGAGCCTTCATGG + Intergenic
961259953 3:125594561-125594583 ATTGCGGGATGCAGCCTCCAGGG + Intronic
961331022 3:126138048-126138070 GTGCTGGGATGGAGCCTCTCTGG - Intronic
961379407 3:126487438-126487460 GTGCGGAACTGCAGCCTCCAAGG + Intronic
963342683 3:144056217-144056239 CTGCAGTGTTGCAGCCTACATGG + Intergenic
965005549 3:163018777-163018799 GGGCAGGGCTGCAAACTCCATGG + Intergenic
965900586 3:173636214-173636236 GTGCAGGGATGCAGCAGCGGTGG - Intronic
966746587 3:183282876-183282898 GGGCAGGGCTGCAGCCTCTGGGG + Intronic
966919629 3:184603130-184603152 TGGCAGGGAAGGAGCCTCCAGGG - Intronic
967556175 3:190861782-190861804 GGGCAGGTATGCAGCCTTCCTGG + Intronic
967965753 3:194959042-194959064 GTCAAGGGATGCAGGCTCCCAGG + Intergenic
968794271 4:2691970-2691992 GTGCAAGTATGCAGCATTCATGG + Intronic
968966983 4:3773735-3773757 GGGCAGGGTTGGAGGCTCCACGG - Intergenic
969912351 4:10457737-10457759 CTGCAGGACTGCAGGCTCCAGGG - Intergenic
970057674 4:11993943-11993965 CTGCAGGGATGGAGCCCTCATGG + Intergenic
970100385 4:12514842-12514864 CTGCAGGGATGGAGCCCTCATGG + Intergenic
971131629 4:23817443-23817465 TTTCAGGGACTCAGCCTCCAGGG + Intronic
971440464 4:26679494-26679516 CTGCAGGGATGGAGCCCTCATGG + Intronic
972895992 4:43620483-43620505 CTGCAGGGATGGAGCCCTCATGG - Intergenic
974301047 4:60067531-60067553 GAGCTGGGATGCAGCTTTCAGGG - Intergenic
974763409 4:66308139-66308161 CTGCAGGGATGGGGCCTTCATGG + Intergenic
977197493 4:94081298-94081320 CTGCAGGGGTGGAGCCTTCAAGG - Intergenic
977942882 4:102877677-102877699 CTGCAGGGGTGGAGCCTTCATGG - Intronic
978809762 4:112837373-112837395 CTGCAGGGATGGAGCCCTCATGG + Intronic
979414300 4:120417483-120417505 CTGCAGGGCTGGAGCCTTCATGG + Intergenic
980485653 4:133454606-133454628 GAGCTGTGATGCAGTCTCCATGG - Intergenic
982268085 4:153558764-153558786 TTTCAGGGAGGCAGCCCCCATGG + Intronic
983132839 4:164043233-164043255 CTGCAGGGATGGAGCCCTCATGG - Intronic
983171411 4:164540619-164540641 CTGCAGGGGTGGAGCCTTCATGG - Intergenic
987316706 5:16730985-16731007 GAGCAGGGAGGCCACCTCCAAGG + Intronic
987542804 5:19277026-19277048 CTGCAGGGATGGAGCCATCATGG + Intergenic
988040927 5:25888182-25888204 CTGCAGGGGTGAAGCCTTCATGG - Intergenic
988147672 5:27331135-27331157 CTGCAGGGATGGAGCCCTCATGG + Intergenic
988170747 5:27652454-27652476 CTGCAGGGGTGCAGCCCTCATGG + Intergenic
988394513 5:30679884-30679906 GTGCAGGGATGGGGCCCTCATGG + Intergenic
988473868 5:31565603-31565625 CTGCAGGGATGGAGCCTCCATGG - Intergenic
988579786 5:32458836-32458858 CTGCAGGGGTGAAGCCTTCATGG - Intergenic
989251388 5:39319674-39319696 GACCAGGGATCCAGCCTCTAGGG + Intronic
990126990 5:52531285-52531307 CTGCAGAGATGCAGCCCTCATGG - Intergenic
991144163 5:63281871-63281893 GTACAGGTTTGCAGCCTGCAGGG + Intergenic
992115391 5:73534265-73534287 GTAAAGGGTTGCAGCCTGCAGGG + Intergenic
995627224 5:114092600-114092622 ATGCAGGGATGGAGCCCTCATGG - Intergenic
996661964 5:126014839-126014861 GTTCTTGGCTGCAGCCTCCAGGG - Intergenic
997016200 5:129937982-129938004 CTGCAGGGGTGGAGCCTTCATGG - Intronic
997046966 5:130330368-130330390 CTGCAGGGGTGAAGCCTTCATGG + Intergenic
998169283 5:139862986-139863008 GTGCTGGGAGTCAGCCTCTAGGG + Intronic
998457890 5:142287782-142287804 GTGCAGGGCTGCAGCTGCCTCGG + Intergenic
999321511 5:150618325-150618347 ATGCAGGGAAGCAGGCTCCTGGG - Exonic
1000367882 5:160507805-160507827 GTGCAGGGAGGTAGCATCCAAGG + Intergenic
1001048507 5:168394761-168394783 GTGAAGGGATGCAGACACAAAGG + Intronic
1001273376 5:170332229-170332251 CAGCAGGGGTGCTGCCTCCAGGG + Intergenic
1002089765 5:176797666-176797688 GTGCAGGTGAGCAGCCCCCAGGG + Intergenic
1002418410 5:179132732-179132754 CTGCAGGCATCCAGGCTCCAGGG + Intronic
1003160147 6:3627592-3627614 GAGCACGGATGCACCCTTCAGGG + Intergenic
1003401206 6:5792769-5792791 GTGCAGAGATGCAGACACCAGGG - Intergenic
1003417351 6:5922855-5922877 GTGCAGGTTTGCACCTTCCATGG + Intergenic
1003728982 6:8799304-8799326 TTGCAGGTATGGTGCCTCCATGG + Intergenic
1004183204 6:13398575-13398597 GTGCACAAATGCAGCGTCCAAGG + Intronic
1005639829 6:27785370-27785392 GTGCAGGGATCCACCCTCTCGGG - Intergenic
1006861470 6:37174245-37174267 CTGTTGGGAGGCAGCCTCCAGGG - Exonic
1007975262 6:46094888-46094910 CTGCAGGGATGGAGCCCTCAGGG - Intergenic
1008363618 6:50650211-50650233 CTGTAGGGATGCAGTCTTCATGG + Intergenic
1009769131 6:68121976-68121998 TTGCAGGGATGGAGCCATCATGG - Intergenic
1010473855 6:76262692-76262714 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1011095477 6:83657218-83657240 GTGAAAGGATTCAGGCTCCAGGG + Intronic
1012367763 6:98463439-98463461 GTGAAGTGCTGCTGCCTCCATGG - Intergenic
1012610259 6:101209483-101209505 GTGCAGTCATTCAGCCTCAAGGG - Intergenic
1013167418 6:107606464-107606486 CAGCAGGGATGCAGCATTCAAGG + Intronic
1016454424 6:144216132-144216154 GTGCAGGGACGCGGCCCACAGGG - Intergenic
1016512970 6:144864076-144864098 GTGCAGGGATGGAGCCCTTATGG + Intergenic
1017723298 6:157259179-157259201 GTGCTGTGAGACAGCCTCCAAGG + Intergenic
1017876582 6:158529792-158529814 GCCCAGCGATGCAGCCTCCTGGG - Intergenic
1018726367 6:166616073-166616095 GTGCAGGGACGCAGCCTCAGTGG + Intronic
1018934630 6:168265644-168265666 GTGCCGGGATGCACCGACCAGGG - Intergenic
1019137890 6:169922538-169922560 GAGGAGGAAGGCAGCCTCCAGGG + Intergenic
1019288161 7:234054-234076 GGGCAGGAAGGCAGCCCCCAGGG - Intronic
1019410310 7:903888-903910 GTGCAGGAAGGCAGCTTCCCAGG - Intronic
1020023719 7:4883900-4883922 GGACGGGGATGCAGCCTCGAGGG + Intergenic
1020161696 7:5778043-5778065 GTCAAGGGATGGAGCCTGCAAGG - Intronic
1020258289 7:6514995-6515017 GGGCAGGAAGGCAGGCTCCAGGG + Intronic
1023866172 7:44239396-44239418 GGGCAGGGAGGCAGCCCCCAAGG - Intronic
1023966458 7:44965404-44965426 GTCCAGGGCTGCAGCCTGCAGGG - Intronic
1024005347 7:45221473-45221495 CTGCAGGGAAACAGACTCCAGGG + Intergenic
1024589352 7:50867734-50867756 GTGCAGGAACACAGCTTCCAGGG + Intergenic
1024710608 7:52010943-52010965 GGGCAGGGAGGCAGAGTCCAAGG - Intergenic
1026434644 7:70384903-70384925 GTGTAGGGAAGCAGCCAGCAAGG - Intronic
1028045078 7:86107838-86107860 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1028099094 7:86798085-86798107 CTGCAGGGGTGGAGCCTTCATGG + Intronic
1028758581 7:94467170-94467192 GGGCAGGGATGATGCCTCCTGGG + Intergenic
1028980486 7:96962593-96962615 ATGCACGGAGGCAGACTCCAGGG - Intergenic
1031488840 7:122363333-122363355 GTGCTGGGCTACAGCCTCCATGG - Intronic
1031576129 7:123417770-123417792 CTGCAGGGATGGAGCCCTCATGG - Intergenic
1031992435 7:128207050-128207072 TTCCAGGGCTGCAGCCTCTAAGG + Intergenic
1032419650 7:131767855-131767877 GAGCAGGGACGCAGCCTCTGCGG - Intergenic
1034107559 7:148503260-148503282 GTGATGGGTTACAGCCTCCAAGG - Intergenic
1034275648 7:149822713-149822735 GCGCAGGGCAGCAGCCACCAAGG + Intergenic
1034742927 7:153495257-153495279 CTGCAGGGGTGGAGCCTGCATGG + Intergenic
1035363094 7:158326282-158326304 CTGCAGGGAGGCAGCCACGAGGG - Intronic
1035381529 7:158444148-158444170 GTGCTGGGCTGCAGCATCCCTGG - Intronic
1035398033 7:158547786-158547808 GTGCAGTGTTTCAGCCTCAAAGG - Intronic
1035425868 7:158772684-158772706 AAGCAGGGATGCACCCTCCAGGG + Intronic
1035690543 8:1556893-1556915 GTGCATGGCTGCTGCCTCCCGGG - Intronic
1035713072 8:1733421-1733443 GTGCAGGGAGCCATCCTCGAGGG - Intergenic
1035870374 8:3130819-3130841 GGGCACGGCTGCAGCCTCTATGG + Intronic
1036780278 8:11642200-11642222 GGGCAGGGAGACAGCCTTCACGG - Intergenic
1037839190 8:22231937-22231959 GGGCATGGAAGCAGCCTCCTTGG - Exonic
1039549013 8:38429941-38429963 GGGCTGGGCTGCAGCCACCACGG + Exonic
1041013846 8:53571318-53571340 TTGCAGGGGTGGAGCCTTCATGG + Intergenic
1041470984 8:58208831-58208853 GTGGAGGGATGCAGGCTCCCAGG - Intergenic
1041849875 8:62378771-62378793 CTGCAGGGATGGAGCCCTCATGG + Intronic
1042266037 8:66910171-66910193 CTGCAGGGATGTAGCCCTCATGG + Intronic
1042877971 8:73457325-73457347 TGGGAGGGCTGCAGCCTCCAAGG - Intronic
1044543185 8:93430493-93430515 GTGCAGTGATTCAGCCACCCGGG + Intergenic
1045252648 8:100494471-100494493 GTGCAGGGATGGAGAATACAGGG + Intergenic
1047231359 8:123000709-123000731 GCCCAGGGAAGCAGCCTCCAAGG - Intergenic
1047358236 8:124143545-124143567 GTGTACATATGCAGCCTCCAGGG + Intergenic
1049189463 8:141278893-141278915 GGCCAGGGCTCCAGCCTCCAGGG + Intronic
1049322336 8:142003191-142003213 GGGCAGGGACTCAGCCTCCCTGG + Intergenic
1049784260 8:144443073-144443095 GTGCTGGGCTGCAGCCTCTTCGG + Intronic
1049799764 8:144512344-144512366 ATGCAGGCAGGCAGCGTCCAGGG + Intronic
1049825601 8:144665782-144665804 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1050286870 9:4112509-4112531 GGCCTGGGATGCAGCTTCCAAGG - Intronic
1050393177 9:5167883-5167905 TTGCTGGTCTGCAGCCTCCACGG + Intronic
1053433220 9:38057911-38057933 GTGCAGCGATTAAGTCTCCAGGG - Intronic
1053481009 9:38416125-38416147 GCGCTGGGATGCCGCCTCCAGGG + Intronic
1055701561 9:78950120-78950142 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1056088972 9:83185898-83185920 ATGCTGGGGTGCAGCCACCACGG + Intergenic
1057237723 9:93378501-93378523 TTGAAGGGTTGCAGCTTCCAGGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1058675144 9:107393859-107393881 GTTCCTGGATGCAGACTCCAAGG + Intergenic
1059497121 9:114719046-114719068 CTGCAGGGTTGCATCCTCAAAGG + Intergenic
1060852430 9:126888863-126888885 GAGCAGGGGTGCAAGCTCCAGGG - Intergenic
1061159665 9:128886009-128886031 TTGTAGGGAGGCAGCGTCCATGG + Exonic
1061189219 9:129071820-129071842 ATGCCTGGAGGCAGCCTCCAGGG + Exonic
1061478245 9:130883565-130883587 GTGCAGGGATGAAGAGGCCAGGG - Intronic
1062173036 9:135145829-135145851 GGTCAGTGATGCAGTCTCCAGGG - Intergenic
1062192535 9:135255299-135255321 GTGCTGGGATGCACTCTCCCGGG + Intergenic
1062417935 9:136462808-136462830 GTGCGGGGTTGCAGCCTTCAGGG - Intronic
1062450763 9:136614824-136614846 CTGCTGAGCTGCAGCCTCCAAGG - Intergenic
1062459370 9:136656525-136656547 AGACAGGGATGAAGCCTCCAGGG + Intergenic
1062459662 9:136657618-136657640 AGACAGGGATGAAGCCTCCAGGG + Intergenic
1062615674 9:137394705-137394727 GAGCGGGGATGCGGCCTCCCCGG + Intronic
1186412147 X:9353444-9353466 GTGCAGGGGAGCAGCAGCCAAGG + Intergenic
1188961876 X:36502343-36502365 CTGCAGGGGTGGAGCCTTCATGG - Intergenic
1189122528 X:38409651-38409673 ATGCAGTGCTGCTGCCTCCAGGG + Intronic
1193467306 X:81865605-81865627 TTGCAGGGATGAAGCCTTCATGG - Intergenic
1193547322 X:82846057-82846079 TTGCAGGGGTGGAGCCTTCAAGG + Intergenic
1194756319 X:97743437-97743459 CTGCAGGGGTGGAGCCTTCATGG + Intergenic
1194779841 X:98010973-98010995 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1194905954 X:99576507-99576529 GTGCAGGGATGGAGCCCGTATGG + Intergenic
1195179239 X:102340154-102340176 GGCCAGGGCTGCACCCTCCATGG - Intergenic
1197479586 X:126966039-126966061 GGGCTGGGATGCATGCTCCAAGG + Intergenic
1197536183 X:127691534-127691556 CTGCAGGGATGGAACCCCCATGG + Intergenic
1197569522 X:128131824-128131846 CTGCAGGGATGGAGCCCTCATGG + Intergenic
1198996378 X:142578453-142578475 CTGCAGGGGTGGAGCCTTCATGG + Intergenic
1199119097 X:144029736-144029758 CTGCAGGGATGGAACCTACATGG + Intergenic
1199639007 X:149841833-149841855 CTGCAGGGCTGCAGCCCTCATGG - Intergenic
1200142605 X:153909493-153909515 GCGCAGGGCTGCAGACTGCAGGG - Exonic
1200180025 X:154144410-154144432 GTGCAGCCACCCAGCCTCCACGG - Intronic
1200185853 X:154182804-154182826 GTGCAGCCACCCAGCCTCCACGG - Intergenic
1200191505 X:154219942-154219964 GTGCAGCCACCCAGCCTCCACGG - Intronic
1200197260 X:154257746-154257768 GTGCAGCCACCCAGCCTCCACGG - Intronic
1201354538 Y:13083145-13083167 GTGCAGGCATACACCCTCCTGGG + Intergenic