ID: 1132947175

View in Genome Browser
Species Human (GRCh38)
Location 16:2538093-2538115
Sequence CATGGGCCCCGCGTCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132947175_1132947186 10 Left 1132947175 16:2538093-2538115 CCCGCGCCGACGCGGGGCCCATG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1132947186 16:2538126-2538148 CCAGCCAGCTGGTGAGCGCGCGG 0: 1
1: 0
2: 2
3: 15
4: 144
1132947175_1132947187 13 Left 1132947175 16:2538093-2538115 CCCGCGCCGACGCGGGGCCCATG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1132947187 16:2538129-2538151 GCCAGCTGGTGAGCGCGCGGCGG 0: 1
1: 0
2: 0
3: 27
4: 102
1132947175_1132947182 -1 Left 1132947175 16:2538093-2538115 CCCGCGCCGACGCGGGGCCCATG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1132947182 16:2538115-2538137 GGCCAGGACCACCAGCCAGCTGG 0: 1
1: 0
2: 4
3: 21
4: 238
1132947175_1132947190 21 Left 1132947175 16:2538093-2538115 CCCGCGCCGACGCGGGGCCCATG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1132947190 16:2538137-2538159 GTGAGCGCGCGGCGGCGGACTGG 0: 1
1: 0
2: 0
3: 30
4: 263
1132947175_1132947189 16 Left 1132947175 16:2538093-2538115 CCCGCGCCGACGCGGGGCCCATG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1132947189 16:2538132-2538154 AGCTGGTGAGCGCGCGGCGGCGG 0: 1
1: 0
2: 1
3: 18
4: 150
1132947175_1132947191 30 Left 1132947175 16:2538093-2538115 CCCGCGCCGACGCGGGGCCCATG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1132947191 16:2538146-2538168 CGGCGGCGGACTGGACGCGCCGG 0: 1
1: 0
2: 1
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132947175 Original CRISPR CATGGGCCCCGCGTCGGCGC GGG (reversed) Exonic
900174428 1:1285519-1285541 CATGCGCCCCGCGTGGGGTCTGG - Intronic
900251007 1:1669691-1669713 CATGGCCACCGCAGCGGCGCTGG + Exonic
920367617 1:205456398-205456420 CGTGGGCGCCGCGCCGGTGCCGG + Intergenic
921866764 1:220094485-220094507 TACGGGCCCCGCCTCGGCGCGGG + Intronic
922100218 1:222472994-222473016 CATGGGCCCGGCCTCGGCCTCGG - Intergenic
1076798093 10:132808532-132808554 CATGGGGTCTGCGTCGGGGCTGG - Exonic
1083623646 11:64060928-64060950 CATGCGCACCGCGGCGGCGGCGG + Intronic
1090751627 11:129750910-129750932 CGTGGGCCCTGCGCCGGTGCTGG + Intergenic
1091866238 12:3839354-3839376 CATGGGCGTCGCGTCCTCGCGGG - Intronic
1094844360 12:34354946-34354968 CCTGGGCCCCGCGCATGCGCAGG + Intergenic
1096983735 12:55743391-55743413 CGAGGGCCCCGCGGCGGCGGCGG + Exonic
1097732980 12:63150801-63150823 CGAGGGCCCCGCGTCGGGACCGG + Exonic
1102339196 12:112108547-112108569 CGCGGGCCTCGCGTAGGCGCCGG - Intronic
1103433011 12:120904059-120904081 CCTGGGCCCCGGGGCGGGGCGGG + Exonic
1103479245 12:121240654-121240676 CATGCGCGCCGCGTCGCCTCTGG - Exonic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1105074526 12:133264216-133264238 TCTGCGCCCCGCGCCGGCGCGGG + Intergenic
1105074529 12:133264223-133264245 GAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1108577729 13:51803994-51804016 CACGTGGCCCGCCTCGGCGCGGG - Intronic
1116945396 14:50831027-50831049 CATGGTTCCCGCGGCGGCGCCGG - Exonic
1117913804 14:60657129-60657151 CTTGGGCGCCGCGTCTGCGCCGG + Intronic
1118259233 14:64232343-64232365 CATGGGGCCAGCGTGGGTGCTGG - Intronic
1122464889 14:101925276-101925298 CCGGGGCGCCGCGTCGGGGCCGG + Exonic
1130335369 15:82952951-82952973 CCAGGGCCCCGGGTCGGCGTGGG - Intronic
1130995043 15:88898937-88898959 CGTCGGCCCTGCGTCGGCCCTGG - Exonic
1132566413 16:625562-625584 CCTGGGCCCCGGGTAGGCTCTGG + Intronic
1132947175 16:2538093-2538115 CATGGGCCCCGCGTCGGCGCGGG - Exonic
1132968518 16:2673304-2673326 TATGGGCCTCGCGTCTGCGCGGG + Intergenic
1133311323 16:4848180-4848202 TCTGCGGCCCGCGTCGGCGCTGG + Intronic
1134149931 16:11797417-11797439 AGTGGGCCGCGCGTCGACGCCGG - Intergenic
1140529017 16:75648182-75648204 GCTGGGCCCCGCCTCGGCGGCGG + Exonic
1141685067 16:85565529-85565551 CATGGGCCCCTCGCCGGTGTGGG - Intergenic
1142549904 17:732302-732324 CCTGGGCCCCGCGGCCGCTCGGG + Intergenic
1146339674 17:32007863-32007885 CACGGGCCCGGCGGGGGCGCGGG + Intronic
1146371165 17:32266227-32266249 GATGCGCTCCGCCTCGGCGCAGG - Exonic
1147819144 17:43231466-43231488 CATGGGCCCCTCGTCCCCTCGGG - Intergenic
1148337534 17:46851638-46851660 CATGCGCCCCCCGCCCGCGCTGG + Exonic
1152398305 17:80048658-80048680 CATGGCCCCCTCCTCGGTGCTGG - Exonic
1154255459 18:12777644-12777666 GAAGGGCCCCGCCTCGGAGCGGG - Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159040283 18:63318412-63318434 CGCAGGCCCCGCGGCGGCGCCGG + Exonic
1161284979 19:3464172-3464194 GCTGGGCCCCGCGTCGGGGTAGG - Intronic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1163490901 19:17616730-17616752 CAAGGGCCCTCCGTGGGCGCTGG - Intronic
1163597113 19:18226514-18226536 CATCGGCCCCGCCTCGAGGCCGG + Intronic
1167383309 19:49150604-49150626 CTTGGGCCCCGCGACTGGGCAGG - Exonic
927990206 2:27442300-27442322 CCTGGGCCCCGCCTCCGCCCCGG - Intergenic
934522054 2:95025792-95025814 CATGGCCCCCGCAGCGGCGACGG + Exonic
935046640 2:99489527-99489549 CATGGGGCTGGCGGCGGCGCGGG + Intronic
948234900 2:236380109-236380131 CATGGGCCCAGCTTCAGTGCAGG - Intronic
948362164 2:237429925-237429947 CATGGGCCCCGCCTCCTGGCTGG - Intergenic
1171876838 20:30585429-30585451 CAAAGGCCCAGCGCCGGCGCAGG + Intergenic
1177011059 21:15730374-15730396 CATGGCCCCCGCGGCGGCGGCGG - Exonic
1178487139 21:33026298-33026320 TCTGGGCCCCGCGCCGGCTCTGG + Exonic
1181478094 22:23180838-23180860 CATGGCCCGCGCGGCGGCGGCGG - Exonic
1183361977 22:37387555-37387577 CCTGGGCACCTCGTCCGCGCTGG + Intronic
1183780380 22:39995315-39995337 CAAGGCCCCCGCGCCGGCGCCGG + Exonic
1183912897 22:41092260-41092282 GGTGGGCTCCGCGTCGGCGCGGG + Exonic
1185398617 22:50604778-50604800 CACGGGCCCCTCGGCGCCGCGGG + Exonic
950759326 3:15206469-15206491 CAGTGGCCCCGCGCCGGGGCAGG - Exonic
968653844 4:1770351-1770373 CCTGGGCCCCGCGGCAGCCCGGG + Intergenic
968672039 4:1856930-1856952 TATGGGTCCTGCGTTGGCGCGGG + Intergenic
981044410 4:140252702-140252724 CATGGGCCCCGCGGCTCCACCGG + Intergenic
981475040 4:145179899-145179921 CATGGGCGTCGCGTCCTCGCGGG + Intronic
982257594 4:153466102-153466124 CATGTGCTCCGCGCCGGGGCGGG + Intergenic
984823598 4:183905668-183905690 CAAGGTCCCCGCGCCGCCGCCGG + Exonic
985467604 5:12460-12482 CAAAGGCGCCGCGCCGGCGCAGG + Intergenic
997302055 5:132813567-132813589 GGTGGGCGCCGCGTCGCCGCGGG - Exonic
1003567033 6:7230589-7230611 CCTGGGCCCCGCAGAGGCGCCGG + Exonic
1007362476 6:41369010-41369032 CCTGCGCCCCCTGTCGGCGCTGG + Intergenic
1007644450 6:43369504-43369526 CCTCGGCCCCGCGTCGCCCCGGG + Intergenic
1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG + Intronic
1019290495 7:247818-247840 CTTGGGTCCCGGGTCGGCCCTGG + Intronic
1020137379 7:5594579-5594601 CCTGGGCCCGGGGGCGGCGCGGG - Intronic
1029546116 7:101211540-101211562 CCTGGGCCCCGGGTCGGAGGAGG + Intronic
1032237930 7:130140908-130140930 GATGGGACGCGCGGCGGCGCCGG - Intergenic
1035496815 7:159335241-159335263 TCTGCGCCCCGCGCCGGCGCGGG + Intergenic
1035496818 7:159335248-159335270 AAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1042155732 8:65842143-65842165 CCTGGGCGCTGCGGCGGCGCGGG - Intronic
1049409042 8:142464293-142464315 CCCGGGCCCCGCGTCTGCTCCGG - Exonic
1061559443 9:131393728-131393750 CATGGGCCCGGCCTGGGCCCGGG - Intergenic
1200032377 X:153306966-153306988 CCTGGGCCCTGCCTCGGGGCGGG - Intergenic