ID: 1132947268

View in Genome Browser
Species Human (GRCh38)
Location 16:2538350-2538372
Sequence GTCTGTCAGCGCCCCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 0, 2: 3, 3: 13, 4: 200}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132947268_1132947284 23 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947284 16:2538396-2538418 GAGGTGTCACCCGGCCCAGCGGG 0: 2
1: 0
2: 0
3: 14
4: 123
1132947268_1132947274 -9 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947274 16:2538364-2538386 CTGACAGACGCGCGGAGGGCGGG 0: 2
1: 0
2: 0
3: 2
4: 71
1132947268_1132947283 22 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947283 16:2538395-2538417 GGAGGTGTCACCCGGCCCAGCGG 0: 2
1: 0
2: 2
3: 9
4: 191
1132947268_1132947275 -8 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947275 16:2538365-2538387 TGACAGACGCGCGGAGGGCGGGG 0: 2
1: 0
2: 0
3: 7
4: 67
1132947268_1132947273 -10 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947273 16:2538363-2538385 GCTGACAGACGCGCGGAGGGCGG 0: 2
1: 0
2: 0
3: 7
4: 97
1132947268_1132947280 4 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947280 16:2538377-2538399 GGAGGGCGGGGGAGGCCGGGAGG 0: 2
1: 2
2: 22
3: 301
4: 2335
1132947268_1132947278 0 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947278 16:2538373-2538395 GCGCGGAGGGCGGGGGAGGCCGG 0: 2
1: 0
2: 17
3: 178
4: 1349
1132947268_1132947286 27 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947286 16:2538400-2538422 TGTCACCCGGCCCAGCGGGGTGG 0: 2
1: 0
2: 0
3: 4
4: 140
1132947268_1132947285 24 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947285 16:2538397-2538419 AGGTGTCACCCGGCCCAGCGGGG 0: 2
1: 0
2: 0
3: 8
4: 99
1132947268_1132947279 1 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947279 16:2538374-2538396 CGCGGAGGGCGGGGGAGGCCGGG 0: 2
1: 0
2: 10
3: 123
4: 870
1132947268_1132947277 -4 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947277 16:2538369-2538391 AGACGCGCGGAGGGCGGGGGAGG 0: 2
1: 1
2: 2
3: 57
4: 443
1132947268_1132947276 -7 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947276 16:2538366-2538388 GACAGACGCGCGGAGGGCGGGGG 0: 2
1: 0
2: 0
3: 18
4: 154
1132947268_1132947281 14 Left 1132947268 16:2538350-2538372 CCTGGCCGGGGGCGCTGACAGAC 0: 2
1: 0
2: 3
3: 13
4: 200
Right 1132947281 16:2538387-2538409 GGAGGCCGGGAGGTGTCACCCGG 0: 2
1: 1
2: 2
3: 25
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132947268 Original CRISPR GTCTGTCAGCGCCCCCGGCC AGG (reversed) Intronic
900420756 1:2555018-2555040 GGCCCTCAGCGCCCCCTGCCAGG - Intergenic
900626333 1:3610365-3610387 GTCTGACAGCCTCCCCGTCCAGG - Intronic
902018746 1:13328644-13328666 GTCGGCCAGCCGCCCCGGCCGGG + Intergenic
903194076 1:21672030-21672052 GACTGTCAGGGCCCCTGGCGAGG + Intergenic
903637886 1:24833805-24833827 GTCGGCCAGCCGCCCCGGCCGGG - Intronic
904209079 1:28873987-28874009 GTGAGTCACCGCGCCCGGCCAGG - Intergenic
904724871 1:32539641-32539663 GGCCGTCAGAGCCCGCGGCCAGG - Intronic
905521573 1:38604533-38604555 GTGAGTCACCGCGCCCGGCCAGG + Intergenic
906495765 1:46303004-46303026 GGCTTTCAGCGCCCCAGGCTGGG + Intronic
907258253 1:53196742-53196764 GTCAGTGAGCGGCCCCTGCCCGG + Exonic
914868902 1:151457642-151457664 GTCAGCCACCGCGCCCGGCCGGG - Intronic
917275910 1:173331982-173332004 GTTTGGCAGCACCCCTGGCCTGG - Intergenic
919978601 1:202628619-202628641 GTCTGTCCCGGCCCCCGGTCAGG - Intronic
921067453 1:211632827-211632849 GTCTGGCAGTGCCCCCTGCACGG - Intergenic
921140264 1:212299024-212299046 GTCGGCCAGCCGCCCCGGCCGGG - Intronic
922218193 1:223538088-223538110 GTCTGTGAGGGCCCCCTTCCTGG + Intronic
922753749 1:228082897-228082919 GTCTGCGTCCGCCCCCGGCCCGG - Intronic
1062937530 10:1399512-1399534 GTCTAGCAGGGTCCCCGGCCTGG + Intronic
1063395632 10:5684960-5684982 CCCTGTCAGCGCCCGCGGCGAGG + Exonic
1065101269 10:22335199-22335221 GAGTGCCGGCGCCCCCGGCCGGG + Intergenic
1065765779 10:29028159-29028181 GTGAGTCACCGCACCCGGCCTGG + Intergenic
1066085420 10:31970081-31970103 GTCGGCCAGCCGCCCCGGCCGGG + Intergenic
1070887915 10:79921106-79921128 GTCCTTCAGCTCCCCAGGCCCGG - Intergenic
1073308057 10:102518811-102518833 GTGAGTCACCGCACCCGGCCTGG + Intronic
1074116396 10:110460232-110460254 GCCTGTCAGAGCCACCAGCCAGG - Intergenic
1074165870 10:110872642-110872664 GCCTCCCAGCGCCCCCGGCGAGG - Intronic
1074417499 10:113280028-113280050 GTGAGTCACCGCTCCCGGCCTGG + Intergenic
1074971667 10:118544230-118544252 TTCTGTCAGCGCCACCTGGCAGG - Intergenic
1075334333 10:121597852-121597874 GTCCTTCCGCGCCCCCCGCCCGG + Intronic
1076594739 10:131618692-131618714 GTCTGTCAGCCCACCTGGGCTGG - Intergenic
1079364771 11:19799643-19799665 GTCTGTCACCTGCCCCTGCCAGG + Intronic
1081658986 11:44876313-44876335 GTGTGCCAGCGTCCCCAGCCTGG + Intronic
1081899793 11:46617920-46617942 ATCTCTCAGCGCCCCCGGGTGGG + Intronic
1083644795 11:64165909-64165931 GTCCCCCCGCGCCCCCGGCCCGG - Exonic
1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG + Intronic
1085267730 11:75247114-75247136 CTCTGTCAGCGGCTCCGGACAGG + Intergenic
1085475030 11:76784001-76784023 GGCTGTCTGCGCCCCCGGCCGGG - Intronic
1086993193 11:93328758-93328780 GTCAGCCACCGCGCCCGGCCAGG - Intergenic
1088571953 11:111231088-111231110 GTCAGCCACCGCGCCCGGCCAGG + Intergenic
1089496474 11:118910723-118910745 GTCTGTCCGCGCGCGGGGCCTGG - Exonic
1091259782 11:134224960-134224982 GTCCGTCGGCGCCCACTGCCCGG + Exonic
1092429946 12:8400209-8400231 GTGAGTCACCGCGCCCGGCCTGG + Intergenic
1092729414 12:11514663-11514685 GTGAGTCACCGCGCCCGGCCAGG - Intergenic
1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG + Intronic
1094772700 12:33683801-33683823 GTCAGCCACCGCGCCCGGCCTGG + Intergenic
1099854055 12:88141957-88141979 ATCTGTCAGGGCCCGCGGCCGGG - Exonic
1100570668 12:95841365-95841387 GTCGGCCAGCCGCCCCGGCCGGG - Intergenic
1103595151 12:122020904-122020926 AAATGTCAGCGCCCCGGGCCTGG - Exonic
1103928897 12:124438553-124438575 GTCTGAGACCGCCCCCGCCCGGG - Intronic
1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG + Intergenic
1110568464 13:76979572-76979594 GTGAGTCACCGCGCCCGGCCTGG - Intergenic
1111482568 13:88850606-88850628 GTCTGTCAGCACCCCAGGTGAGG - Intergenic
1113780557 13:112974315-112974337 GTCTGCAAGGGCCCCCGGCGTGG + Intronic
1113887228 13:113667317-113667339 GTCTGTGAACGCTCCCGGCTTGG + Exonic
1117310325 14:54515372-54515394 GTGAGTCACCGCGCCCGGCCGGG + Intronic
1118341164 14:64895671-64895693 GTCGGCCAGCCGCCCCGGCCGGG - Intergenic
1118808958 14:69260216-69260238 GGCTGCGAGCGCCCCCGCCCCGG + Exonic
1120993185 14:90396755-90396777 CTCTGTCTTCGCCCCCGCCCAGG + Intronic
1121273510 14:92652669-92652691 GTCTGTCATGGCCACCGACCAGG + Exonic
1125194463 15:37030617-37030639 GTGAGTCATCGCCCCCAGCCTGG + Intronic
1126195240 15:45923668-45923690 GTGAGTCACCGCACCCGGCCAGG + Intergenic
1127382189 15:58439722-58439744 GTGAGCCACCGCCCCCGGCCAGG + Intronic
1130336600 15:82962086-82962108 GTGAGTCACCGCACCCGGCCTGG - Intronic
1132423931 15:101698052-101698074 GTGAGTCACCGCGCCCGGCCTGG - Intronic
1132760722 16:1507393-1507415 GTCTGCCTGCACCCCTGGCCTGG - Intronic
1132878597 16:2151008-2151030 GCCTGGCAGCGTCCCCAGCCGGG - Intronic
1132942351 16:2514413-2514435 GGCTGGCAGGGCCGCCGGCCCGG - Intronic
1132947268 16:2538350-2538372 GTCTGTCAGCGCCCCCGGCCAGG - Intronic
1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG + Intergenic
1136912125 16:34153324-34153346 GTCTGTCAGACCCCCCGTGCCGG + Intergenic
1137609086 16:49807147-49807169 GTGAGCCACCGCCCCCGGCCTGG - Intronic
1138552150 16:57753901-57753923 GGCTGTGAGCGCTCCTGGCCAGG - Intronic
1139259634 16:65579243-65579265 GTCTTTCAACTCCCCCTGCCCGG + Intergenic
1141748371 16:85941519-85941541 GTGAGTCAGCGCGCCCGGCCGGG + Intergenic
1141882127 16:86867155-86867177 GGCTGTTAGCACCTCCGGCCTGG + Intergenic
1142055012 16:87988545-87988567 GTGAGCCACCGCCCCCGGCCGGG + Intronic
1142297550 16:89235874-89235896 GTGAGCCACCGCCCCCGGCCTGG - Exonic
1142396804 16:89836695-89836717 GTGAGCCACCGCCCCCGGCCGGG - Intronic
1144413299 17:15022059-15022081 GTCAGCCACTGCCCCCGGCCAGG - Intergenic
1144496536 17:15749576-15749598 GTCGGTCAGCGGCCCGAGCCCGG + Intergenic
1144905042 17:18635123-18635145 GTCGGTCAGCGGCCCGAGCCCGG - Exonic
1147217762 17:38911003-38911025 GTGAGTCACCGCGCCCGGCCAGG + Intronic
1147264229 17:39225371-39225393 GCCTGTCCGCGCCCCGGGCCCGG - Intronic
1147720473 17:42536619-42536641 CTCGGTCAGCTCCCCCGGCACGG - Exonic
1147724944 17:42561294-42561316 GTCAGCCACCGCGCCCGGCCGGG + Intergenic
1149349639 17:55773910-55773932 GCCTGTCAGTGCACCCAGCCAGG + Intronic
1150285446 17:63951396-63951418 GTCTGTCTGAGCCCCAGCCCCGG + Intronic
1151660442 17:75515665-75515687 TCCGGTCAGCGCCCCCGGTCCGG - Intergenic
1152129351 17:78466675-78466697 GTCCGTCAGCGCCCGCTTCCTGG - Exonic
1152280164 17:79380461-79380483 GGCTGTCAGCGCCCCTGGCCTGG + Intronic
1152648578 17:81481648-81481670 GACTGTGAGCGCCCCCGCCCCGG + Intergenic
1152673436 17:81623514-81623536 GTCAGCCACCGCGCCCGGCCGGG - Intronic
1152781407 17:82228819-82228841 CCCCGTCGGCGCCCCCGGCCCGG - Intronic
1152860778 17:82696148-82696170 GTGAGCCACCGCCCCCGGCCCGG + Intronic
1153020130 18:621367-621389 GTGTGTCAGCGTCACCGGACTGG + Intronic
1155299763 18:24418619-24418641 GTCTGTCAGTGCACCAGGACAGG + Intergenic
1157863111 18:51159400-51159422 GTCTGTTAGGGCCTCCGGCCTGG - Intergenic
1160805772 19:991666-991688 GTCAGTCCACGCCCCCAGCCAGG - Intronic
1160832995 19:1112053-1112075 GTGGGTCAGGGCCCCCTGCCAGG + Exonic
1161019947 19:2004577-2004599 GTGAGCCACCGCCCCCGGCCAGG + Intronic
1161809163 19:6461693-6461715 GTGAGTCACCGCGCCCGGCCTGG + Intronic
1161851491 19:6740045-6740067 CTCTCTCAGCCGCCCCGGCCTGG - Intronic
1162279013 19:9680252-9680274 GGGTGTCAGCGCCCCCCGCCCGG + Intergenic
1162506699 19:11090131-11090153 GTCAGCCACCGCGCCCGGCCGGG + Intronic
1163035342 19:14566287-14566309 GGCTGTCAGGGTCCCTGGCCAGG + Intronic
1163531242 19:17850230-17850252 GACTGTCAGCTCCCCTGGACAGG - Intergenic
1163629486 19:18410412-18410434 GTGAGTCACCGCGCCCGGCCTGG + Intergenic
1164066527 19:21721355-21721377 GTCGGCCAGCCGCCCCGGCCGGG + Intergenic
1165107924 19:33485209-33485231 GTGAGTCAGCGCGCCCAGCCAGG - Intronic
1165828719 19:38720005-38720027 GTCTGCCAGAGCCCCCAGGCAGG + Intronic
1166534452 19:43563537-43563559 GTCTGACTGCTCCCCAGGCCAGG + Intronic
1166774184 19:45302597-45302619 GTCTGCCAGCTGCCCCGGCCAGG + Exonic
926254253 2:11176496-11176518 GTGTGCCACCGCGCCCGGCCTGG + Intronic
926749862 2:16190141-16190163 GTGAGCCACCGCCCCCGGCCTGG - Intergenic
926854572 2:17240554-17240576 GTCAGCCACCGCGCCCGGCCCGG + Intergenic
927894195 2:26771053-26771075 GGCTGGCAGCGCTCCCGGCTGGG - Intronic
929788815 2:45009621-45009643 ATCTGTCAGCGGAGCCGGCCGGG - Intergenic
931763137 2:65433580-65433602 GTGTGCCACCGCGCCCGGCCGGG - Intergenic
933016266 2:77131114-77131136 GTCAGCCACCGCGCCCGGCCTGG + Intronic
934750941 2:96793679-96793701 GTCAGCCACCGCGCCCGGCCTGG - Intronic
940134970 2:150425482-150425504 TTCTGCCAGCTCCCCCGGCCTGG + Intergenic
943087860 2:183334812-183334834 GTGAGTCACCGCGCCCGGCCAGG + Intergenic
1170930868 20:20768534-20768556 GCCGGTCGGCGCCACCGGCCAGG + Intergenic
1170933866 20:20793156-20793178 GTGAGCCACCGCCCCCGGCCGGG + Intergenic
1171769093 20:29307742-29307764 GTCTGTCAGAGCCCCTGTGCCGG - Intergenic
1171812270 20:29754178-29754200 GTCTGTCAGAGCCCCTGTGCCGG - Intergenic
1171953259 20:31440204-31440226 GTCTGTCACAGCCCCCTGCTGGG - Intergenic
1172421907 20:34825314-34825336 GTCTGAGAGCGGGCCCGGCCCGG - Intronic
1174471624 20:50765478-50765500 GTGAGTCACCGCGCCCGGCCAGG + Intergenic
1175237680 20:57525508-57525530 GTCTCCCAGCGCCCCCTGCGGGG - Intronic
1175238169 20:57526834-57526856 GTCTCCCAGCGCCCCCTGCAAGG - Intergenic
1175435029 20:58940375-58940397 GTGAGCCAGCGCGCCCGGCCAGG - Intergenic
1178692024 21:34758030-34758052 GTGAGCCAGCGCGCCCGGCCAGG + Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179977258 21:44875085-44875107 GGCTGCCAGAGACCCCGGCCAGG - Intergenic
1182848571 22:33451837-33451859 GTGAGCCACCGCCCCCGGCCGGG + Intronic
1183194563 22:36344485-36344507 GCATGTCAGCGCCCCTGGGCGGG - Intronic
1183486241 22:38089077-38089099 GCCTGTGAGTGCCCCCGCCCCGG - Exonic
1183506985 22:38214824-38214846 GTCTGGCCCCGCCCACGGCCCGG + Exonic
1184161392 22:42699529-42699551 CTCAGTCAGCTCCCCGGGCCAGG - Intronic
950140338 3:10610956-10610978 GACTGTCAGCGAGCCCAGCCGGG - Intronic
950509816 3:13419632-13419654 GTCTGTGACCGCCCTCGCCCTGG - Intronic
950609258 3:14114901-14114923 GTCAGTCTCCGCCCCCGCCCAGG + Intronic
951226364 3:20125912-20125934 TTCTGTCAGCACACTCGGCCAGG + Exonic
954413673 3:50382408-50382430 GTGTGTCAGTGCCCCAGGGCCGG - Intronic
955702520 3:61696217-61696239 GTGAGTCACCGCGCCCGGCCTGG - Intronic
958026101 3:88050633-88050655 GTGAGACACCGCCCCCGGCCGGG + Intergenic
960110198 3:113838287-113838309 GTCAGCCACCGCCCCCGGCCAGG - Intronic
961013473 3:123450032-123450054 GTCTTCCCCCGCCCCCGGCCAGG + Intergenic
961858193 3:129893471-129893493 GTGAGTGAGCGCCCCCGCCCCGG - Intronic
966919958 3:184604647-184604669 GTGGGTCAGAGCCCTCGGCCTGG - Intronic
966926265 3:184646530-184646552 GTGAGTCACTGCCCCCGGCCTGG + Intronic
967507897 3:190273818-190273840 GTGAGTCACCGCGCCCGGCCAGG + Intergenic
968550056 4:1217459-1217481 GTCTGTCAACGCCCCCTGCCAGG + Intronic
968667119 4:1828212-1828234 GGCGGTCAGCCCCCCCCGCCCGG - Intronic
971258003 4:25031085-25031107 CTCTGTCCCCGCGCCCGGCCCGG - Intergenic
972970858 4:44574650-44574672 GTGAGTCACCGCGCCCGGCCTGG + Intergenic
974800194 4:66807356-66807378 GTGTGACAGCGGCCCAGGCCAGG - Intergenic
976225416 4:82791973-82791995 GTCAGCCAGCGTGCCCGGCCAGG - Intronic
977659154 4:99563101-99563123 GTGAGTCACCGCGCCCGGCCAGG + Intronic
985580339 5:692729-692751 GTCTGACAGCCCCACCTGCCAGG + Intronic
985594997 5:784110-784132 GTCTGACAGCCCCACCTGCCAGG + Intergenic
991713005 5:69426613-69426635 GTGAGTCACCGCGCCCGGCCTGG + Intronic
992233528 5:74685556-74685578 GACGGTGAGCGCTCCCGGCCCGG + Exonic
993116215 5:83722426-83722448 GTCGGCCAGAGCCCCCGTCCCGG - Intergenic
997342345 5:133154475-133154497 GTGAGTCACCGCGCCCGGCCTGG - Intergenic
997984628 5:138492452-138492474 GTCTTTCAGCGGCCCCAGCCCGG + Intergenic
998173349 5:139885346-139885368 GCCTCTCAGCGGCCTCGGCCTGG - Intronic
1001565426 5:172696635-172696657 GTCGGTCAGCCTCCCAGGCCTGG - Intergenic
1001608239 5:172979363-172979385 GTCAGCCACCGCACCCGGCCAGG - Intergenic
1003205488 6:4005826-4005848 GTGAGCCAGCGCACCCGGCCAGG + Intergenic
1004337182 6:14774846-14774868 GTGAGTCACCGCGCCCGGCCAGG - Intergenic
1005837292 6:29718904-29718926 GTCGGCCAGCCGCCCCGGCCGGG + Intergenic
1005968294 6:30742595-30742617 GTCTGCGAGCGGCCCCTGCCCGG - Exonic
1005991786 6:30907800-30907822 GTGAGTCACCGCGCCCGGCCTGG + Intergenic
1006428747 6:33982436-33982458 GGCTGCCAGCGCCCCCGCCAAGG + Intergenic
1006757370 6:36428162-36428184 GTCAGCCACCGCGCCCGGCCAGG - Intronic
1007327457 6:41073218-41073240 GGCGGCCAGCGGCCCCGGCCCGG + Intronic
1007519174 6:42438325-42438347 GTGAGCCACCGCCCCCGGCCAGG - Intronic
1009429145 6:63547470-63547492 GTCTGCCACCTCGCCCGGCCAGG + Intronic
1009958412 6:70486644-70486666 GTGAGTCACCGCACCCGGCCTGG - Intronic
1011110174 6:83828827-83828849 GTCTGTCACTGCCTCCGGACAGG - Intergenic
1013066522 6:106689303-106689325 GTGAGTCACCGCGCCCGGCCTGG + Intergenic
1014764153 6:125389116-125389138 GTCGGCCAGCCGCCCCGGCCGGG - Intergenic
1016825923 6:148388409-148388431 GTCTGTCTGAGCCCACAGCCTGG - Intronic
1017838097 6:158198686-158198708 GTGAGCCAGCGCGCCCGGCCTGG + Exonic
1018628731 6:165804796-165804818 GTCAGTCTCCGCCCGCGGCCCGG - Intronic
1019354396 7:571243-571265 GTCTGTCCGAGACCCCAGCCAGG + Intronic
1019910050 7:4094742-4094764 GTCTTTCAGGGCACCAGGCCAGG + Intronic
1019979719 7:4612586-4612608 GTCTCTCATCGCCCCCAGACAGG + Intergenic
1026415058 7:70170886-70170908 GTGAGCCACCGCCCCCGGCCGGG + Intronic
1027548048 7:79555253-79555275 GTGAGCCACCGCCCCCGGCCAGG + Intergenic
1029221099 7:98991104-98991126 GGCTGTCCGCTTCCCCGGCCTGG - Intronic
1029458356 7:100682252-100682274 GGCTGTCAGGGCCCCCTGGCCGG + Intronic
1033050019 7:137995613-137995635 GTCAGCCACCGCGCCCGGCCAGG + Intronic
1033795077 7:144836400-144836422 GTGAGTCACCGCACCCGGCCAGG - Intergenic
1034424311 7:151006713-151006735 GTGTGTCAGGGCCCCAGGCTCGG + Intronic
1035388308 7:158489161-158489183 GTGAGTCACCGCGCCCGGCCAGG - Intronic
1035391893 7:158509691-158509713 GTCTGTCAGCGCCCACAGGCAGG + Intronic
1035434384 7:158848640-158848662 GTGAGTCACCGCGCCCGGCCTGG - Intergenic
1037987467 8:23299002-23299024 GTCTCTCAGAGCCCCAGGCCTGG - Intronic
1040922702 8:52641099-52641121 GTGAGTCATCGCGCCCGGCCAGG - Intronic
1049248039 8:141573131-141573153 GTCTGTCAGAGCCACCTTCCAGG + Intergenic
1057992168 9:99781810-99781832 GTCTGGGAGGGCCACCGGCCAGG + Intergenic
1061010590 9:127952221-127952243 GGACGTCAGCGCCCCGGGCCAGG + Intronic
1061453399 9:130681140-130681162 GGCCCTCAGCGCCCCCAGCCCGG - Intronic
1062046662 9:134427559-134427581 GTCTGTCAGCACACCTGGGCGGG + Intronic
1062171323 9:135136419-135136441 CTCTGTCAGGGCCCCGGTCCTGG - Intergenic
1062347674 9:136122903-136122925 GCCTTCCTGCGCCCCCGGCCTGG + Intergenic
1062615856 9:137395366-137395388 GCCTGCCAGCGTCCTCGGCCCGG - Exonic
1186343183 X:8664473-8664495 GTGAGCCACCGCCCCCGGCCAGG + Intronic
1190246690 X:48695596-48695618 GTCAGTCAGAGCACCCAGCCAGG - Exonic
1190318775 X:49167152-49167174 GTGAGTCAGCGCCCCTGGACGGG + Intronic
1192245760 X:69370268-69370290 GTCTCTCAACGCCTCCAGCCTGG - Intergenic
1200252086 X:154559162-154559184 TCCTGTCAGCGCCCTCTGCCAGG + Intronic
1200265682 X:154645254-154645276 TCCTGTCAGCGCCCTCTGCCAGG - Intergenic
1200483364 Y:3735734-3735756 GTGAGTCACCGCGCCCGGCCTGG + Intergenic
1201075441 Y:10184163-10184185 GTCTGTCAGAGCCCCCGTGCTGG + Intergenic