ID: 1132953495

View in Genome Browser
Species Human (GRCh38)
Location 16:2578324-2578346
Sequence CAGATGGTACAGGGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 2, 1: 2, 2: 2, 3: 19, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132953488_1132953495 5 Left 1132953488 16:2578296-2578318 CCTCCATAGTGAAAAAATGAAAA 0: 2
1: 0
2: 4
3: 65
4: 616
Right 1132953495 16:2578324-2578346 CAGATGGTACAGGGGCTGCAGGG 0: 2
1: 2
2: 2
3: 19
4: 304
1132953489_1132953495 2 Left 1132953489 16:2578299-2578321 CCATAGTGAAAAAATGAAAAAAG 0: 1
1: 1
2: 7
3: 163
4: 2331
Right 1132953495 16:2578324-2578346 CAGATGGTACAGGGGCTGCAGGG 0: 2
1: 2
2: 2
3: 19
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132953495 Original CRISPR CAGATGGTACAGGGGCTGCA GGG Intronic
900565857 1:3331533-3331555 CACATGGGACGGGGGCTGCCAGG + Intronic
901089041 1:6629415-6629437 CAGATGGGGCAGGGGCTCCCAGG - Intronic
902068420 1:13710219-13710241 TAGAGGGTGCTGGGGCTGCAGGG + Intronic
902287176 1:15414175-15414197 CAGTGGGGACAGGGCCTGCAAGG - Intronic
902472238 1:16657051-16657073 CAGCTTGTGCAGCGGCTGCAGGG - Intergenic
902486565 1:16750395-16750417 CAGCTTGTGCAGCGGCTGCAGGG + Intronic
902504403 1:16930005-16930027 CAGCTTGTGCAGCGGCTGCAGGG + Exonic
903240356 1:21978576-21978598 TAGATGGTCCAAGGGCTGCCTGG - Intronic
903244103 1:22003210-22003232 TAGATGGTCCAAGGGCTGCCTGG - Intronic
903268760 1:22174684-22174706 GAGATGCTACTGGGGCTGCTAGG + Intergenic
903416560 1:23187501-23187523 CAGATGGGAGAGGGCCTTCAAGG - Intergenic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
906017970 1:42599926-42599948 CAGAAGGTAAAGGGGAAGCAAGG + Intronic
906524739 1:46487608-46487630 CAGATAGCACAGGAGCTGCTGGG - Intergenic
907983689 1:59509499-59509521 CAGATGGGGCAGTGGATGCAGGG - Intronic
910503267 1:87919063-87919085 CAGCTGCTAGAAGGGCTGCAAGG - Intergenic
911060125 1:93740418-93740440 CTGATGGGACTGGGGTTGCAGGG - Intronic
915196777 1:154195408-154195430 CAGAGGGAAGAGGGGCTGAATGG + Intergenic
917018384 1:170560143-170560165 CAGAAGGTAAAGGGGAAGCAAGG - Intergenic
917669303 1:177257284-177257306 CAGCTGGTGCAGGGTCTCCAGGG - Exonic
917967128 1:180185990-180186012 ACCATGGTGCAGGGGCTGCAAGG - Intronic
919394217 1:197023955-197023977 CAGAAGGTAAAGGGGAAGCAAGG - Intergenic
920723818 1:208415032-208415054 CAGCAAGTACAGGGGCTGGAAGG - Intergenic
922566466 1:226604762-226604784 CTGTTGGTTCAGAGGCTGCAGGG + Exonic
923473968 1:234315928-234315950 CAGATGGGACGGAGGCTTCATGG - Intronic
1062947092 10:1469802-1469824 GAGATGGTAAAAGGGCTCCATGG + Intronic
1063394475 10:5674148-5674170 CAGAAGGTAAAGGGGAAGCAGGG + Intergenic
1063401119 10:5746859-5746881 CAGATGGTAGAGAGACTGGAAGG - Exonic
1066213004 10:33258128-33258150 CAGCTGGTACTTGGGCTTCAGGG - Intronic
1066321986 10:34311910-34311932 CAGATGTTACAGGTGATTCAGGG - Intronic
1067082149 10:43217910-43217932 CAGATGGGACAAGGGCTCCCTGG - Intronic
1068301218 10:55143121-55143143 CAGAAGGTAAAGGGGAAGCAAGG - Intronic
1068452769 10:57212969-57212991 CAGAAGGTAAAGGGGAAGCAAGG + Intergenic
1068519186 10:58060599-58060621 AAGATGTTACAGTGGCAGCAGGG + Intergenic
1069267077 10:66473398-66473420 CAGAAGGCAAAGGGGCAGCAAGG - Intronic
1070566443 10:77606895-77606917 CAGAGGGTGCAAGGGTTGCACGG - Intronic
1071356368 10:84800308-84800330 CAACTGGCACAGGGGCTCCAAGG - Intergenic
1071597783 10:86940690-86940712 CAGCTGGGGCAGGGGCTGCCTGG + Intronic
1072785040 10:98273571-98273593 CAGGTGGCACTGGGGGTGCAGGG - Intergenic
1074036698 10:109746322-109746344 CAGATAGAAAAGGGGCTTCAGGG - Intergenic
1074285180 10:112091277-112091299 CACATGGCACAAGGGGTGCAAGG - Intergenic
1075946439 10:126437308-126437330 CAGCTGGTTCAGGGACTGGAAGG - Intronic
1076475493 10:130748848-130748870 CAGAGGGCACAGAGGCTGCTGGG - Intergenic
1077045841 11:544826-544848 CCGATGGGACAGGCCCTGCAGGG + Intronic
1077309533 11:1882250-1882272 CAGATGGCCCAGGCCCTGCAGGG - Intronic
1077343751 11:2037236-2037258 CAGAGGCAAGAGGGGCTGCAAGG - Intergenic
1078577464 11:12514106-12514128 CACTTGGAACAGGGGCTGTAGGG - Intronic
1078647204 11:13151677-13151699 GAGATGGTAAAGAGGATGCAGGG + Intergenic
1081757379 11:45554313-45554335 CAGATGGGGCAGAGGCTCCAAGG - Intergenic
1083171003 11:60924137-60924159 CACATGGGACGGGAGCTGCAGGG - Intergenic
1083237269 11:61359245-61359267 AAGAAGGTCCAAGGGCTGCAGGG + Intronic
1083285591 11:61656624-61656646 GTGAGGGTACAGGGGGTGCAGGG + Intergenic
1083638687 11:64133799-64133821 CAGCAGGTGCTGGGGCTGCAAGG - Intronic
1084708450 11:70829517-70829539 CAGATGGGACATGGGGTGCAGGG - Intronic
1084859195 11:72007160-72007182 CTGCTGGGACAGGGGCTGCAGGG - Intronic
1086986588 11:93257086-93257108 CAGAAGGGTCAGGGCCTGCAAGG + Intergenic
1087938467 11:104063663-104063685 CAGAAGGTAAAGGGGAAGCAAGG + Intronic
1088358739 11:108969465-108969487 CAGATGGCACAGGGTCCCCAGGG + Intergenic
1089684964 11:120140914-120140936 TAGATGTTACAGGGGTTGAATGG - Intronic
1089688245 11:120170251-120170273 CAGAGGGTCCAGGGGCTCCCGGG - Exonic
1089729856 11:120512745-120512767 CAGCTGGGACAGGGGGTTCAAGG + Intronic
1091156085 11:133374851-133374873 CATATGGTACCTTGGCTGCATGG - Intronic
1202826737 11_KI270721v1_random:92425-92447 CAGAGGCAAGAGGGGCTGCAAGG - Intergenic
1092763902 12:11835477-11835499 CAAATGGAACAGAAGCTGCATGG - Intronic
1092850204 12:12619182-12619204 CAGATGGGACAGGGGCAGTGGGG + Intronic
1095145678 12:38722979-38723001 CCGATGGCACAGGGGAAGCAAGG - Intronic
1095175926 12:39091980-39092002 CAGAGGTAACAGGCGCTGCAAGG - Intergenic
1095776671 12:46018029-46018051 CAGCGGGAACAGGGGCTGCGCGG + Intergenic
1096179935 12:49545058-49545080 CAGGTGATACAGGGACTTCAAGG - Intronic
1096445445 12:51686690-51686712 AAGATGGTGATGGGGCTGCAGGG - Intronic
1099914464 12:88874804-88874826 CAGAAGGTAAAGGGGAAGCAAGG + Intergenic
1101330651 12:103755294-103755316 CAGGTGGTACTTGGCCTGCAGGG - Exonic
1101817883 12:108159756-108159778 GAGATGCTGCAGGGGCTGCTGGG - Intronic
1101861800 12:108488515-108488537 CAGATGTTGATGGGGCTGCAGGG + Intergenic
1102513186 12:113429246-113429268 CAGGTGGTGCAGAGGCTGCAGGG + Exonic
1104257622 12:127154119-127154141 CAGATGGGACAGGGCTTGCGGGG - Intergenic
1104777088 12:131396566-131396588 CAGAAGGTAAAGGGGAAGCAAGG + Intergenic
1104934971 12:132359726-132359748 CAGATGTGGCAGGGGCTTCATGG - Intergenic
1105519189 13:21116279-21116301 CAGAAGCTTCAGGGACTGCAGGG - Intergenic
1106077757 13:26475768-26475790 GAGAGGGTTCAGGAGCTGCAGGG + Intergenic
1106550889 13:30769765-30769787 CCGATGGCACAGAGCCTGCATGG - Intergenic
1107744928 13:43493940-43493962 CAGAAGGTAAAGGGGAAGCAAGG + Intronic
1108994531 13:56711051-56711073 CAGATGTGACAGAGGCTGTATGG + Intergenic
1110394504 13:75013862-75013884 AAGAGGGTACTGGGGCTGTATGG - Intergenic
1110724362 13:78802668-78802690 CAGAAGGTAAAGGGGAAGCAAGG + Intergenic
1112417946 13:99219492-99219514 CATATGGCCCATGGGCTGCAGGG - Intronic
1112977931 13:105343917-105343939 CACATGATACAGGGACTGAAAGG - Intergenic
1113033260 13:106017704-106017726 CAGATGGGGCAGGGGCAGCATGG - Intergenic
1113187891 13:107710539-107710561 CAGAAGGCAAAGGGGATGCAAGG + Intronic
1114654762 14:24309637-24309659 CAGGAGGAACAGGGGATGCATGG - Intronic
1115016638 14:28623459-28623481 CAGATTGTTCAGTGCCTGCATGG - Intergenic
1116221739 14:42096292-42096314 CAGAGGGCACAAAGGCTGCAGGG + Intergenic
1116580595 14:46636626-46636648 CAAATGATACAAGGGCTGAAAGG - Intergenic
1116622983 14:47229357-47229379 GAGATGGTATAGTGGCTTCATGG - Intronic
1117514415 14:56486334-56486356 CACATGGTAGAAGGGCTGAAAGG + Intergenic
1120511520 14:85421523-85421545 CAGATGGAGCTGAGGCTGCAAGG + Intergenic
1121576106 14:94989524-94989546 CAGAGGGAATAAGGGCTGCAAGG + Intergenic
1121665637 14:95670095-95670117 GAGATGATACAGGGGCTCCTGGG - Intergenic
1122272993 14:100576664-100576686 CAGATGGTACAGGGCAGGAAAGG + Intronic
1122421414 14:101579800-101579822 CAGAGGGGACAGGGGCTCCAGGG - Intergenic
1122651657 14:103229921-103229943 TAGAGGGTACAGGGGCAGCAGGG + Intergenic
1122953398 14:105058744-105058766 CAGATGGCTCAGGGCATGCAGGG + Intronic
1128328700 15:66741882-66741904 CAGAGGCTACTGAGGCTGCAAGG + Intronic
1128562224 15:68676447-68676469 CAGAGGGTAAGGGGTCTGCAAGG + Intronic
1128654062 15:69446324-69446346 CAGATGGTGCAGAGTCTGAATGG + Exonic
1129033162 15:72632740-72632762 TAGATTTTGCAGGGGCTGCATGG - Intergenic
1129216721 15:74104490-74104512 TAGATTTTGCAGGGGCTGCATGG + Intronic
1129318179 15:74758853-74758875 CAGATGGGGCAGTGGCTGTATGG - Intergenic
1129407952 15:75331595-75331617 TAGATTTTGCAGGGGCTGCATGG - Intergenic
1129471117 15:75754374-75754396 TAGATTTTGCAGGGGCTGCATGG - Intergenic
1129733888 15:77948803-77948825 TAGATTTTGCAGGGGCTGCATGG + Intergenic
1129841696 15:78747200-78747222 TAGATTTTGCAGGGGCTGCATGG - Intergenic
1131261812 15:90891546-90891568 CAGTCGGTACAGGTTCTGCAGGG - Exonic
1131268219 15:90931339-90931361 CAGGTGGTGAAGGGGCTTCAGGG - Exonic
1132557999 16:580877-580899 CAGATGGATCAGGCCCTGCACGG - Exonic
1132953495 16:2578324-2578346 CAGATGGTACAGGGGCTGCAGGG + Intronic
1132960857 16:2621843-2621865 CAGATGGTACAGGGGCTGCAGGG - Intergenic
1132968825 16:2674899-2674921 CAGAGGGCAGAGGGGCTGCCTGG - Intergenic
1133444667 16:5849743-5849765 AAGATCATACAGGAGCTGCAGGG - Intergenic
1133648292 16:7785085-7785107 CTGATGGCAGAAGGGCTGCATGG - Intergenic
1134634074 16:15778921-15778943 CAGATGGTACAGAGGATGGGAGG + Intronic
1135186422 16:20319865-20319887 CAGAAGGTAGGGTGGCTGCATGG - Intronic
1135583737 16:23650791-23650813 CAGATGTCACAGTGCCTGCAGGG + Intronic
1135835180 16:25818998-25819020 CAGATTCTACAGGGCCTGCATGG + Intronic
1136032078 16:27510688-27510710 CAGAAGGTGAAGTGGCTGCAAGG - Intronic
1137066164 16:35846295-35846317 CAGAGGCTACAGGGGCTGAAGGG + Intergenic
1137724077 16:50645403-50645425 CAGCTGGTACAAGGGCCTCAAGG + Intergenic
1139700970 16:68707794-68707816 CAGTGGGTACAGGGAATGCAGGG - Intronic
1139911284 16:70399016-70399038 CAGAGAGCACAGGGGCTTCAGGG + Exonic
1140785641 16:78339388-78339410 CAGAAGGTACAAAGGCTCCAGGG - Intronic
1141173472 16:81704845-81704867 CAAATGGGAAATGGGCTGCAGGG - Intronic
1142110626 16:88329216-88329238 CAGGTGGTGAAGGGGCTCCAGGG + Intergenic
1142218093 16:88839681-88839703 CACATGGTGCAGTGGCTGGATGG - Intronic
1142893558 17:2960372-2960394 CAGCTGGGACAGGGTCTGTAGGG + Intronic
1143034440 17:3986367-3986389 CTGCTGGGGCAGGGGCTGCAGGG - Intergenic
1144945340 17:18966862-18966884 GAGGGGGTAGAGGGGCTGCAGGG + Intronic
1145010864 17:19366908-19366930 CAGAAGCTACAGGGGCTGAGAGG + Intronic
1145255078 17:21317975-21317997 CACAGGGTACAGGGGAGGCAGGG - Intergenic
1145291975 17:21554033-21554055 CTGCTGCTCCAGGGGCTGCAGGG - Intronic
1146264894 17:31446314-31446336 CAGAAGGGACAGAAGCTGCAAGG - Intronic
1146357020 17:32142777-32142799 CAGGGGCGACAGGGGCTGCAGGG - Intronic
1147614360 17:41819585-41819607 GGGATGGACCAGGGGCTGCAGGG + Exonic
1147627230 17:41908008-41908030 CAGGTGGAGCAGGGGCCGCAGGG + Intronic
1147919603 17:43907665-43907687 CAGCTGGTACGGGGGCAGCCAGG + Intronic
1148909159 17:50931235-50931257 CAGGAGGTGCAGGGGCAGCAGGG + Intergenic
1149389229 17:56172887-56172909 CAGATGATACAAGTGCTCCAGGG - Intronic
1150206492 17:63412500-63412522 CAGCTGGGACAGCGGCAGCAGGG - Intronic
1150782564 17:68134903-68134925 CAGCTGGTCCAGGATCTGCACGG + Intergenic
1151464293 17:74274565-74274587 CAGGGTGTACAGAGGCTGCAGGG - Intronic
1151499778 17:74481366-74481388 CGGAGGGTACAGAGGCTGCTGGG + Intronic
1151566939 17:74903893-74903915 CACCTGGCACAGGGGCTGCCAGG - Intergenic
1151656155 17:75496981-75497003 CAGAGGGAACAGGGGCCGGAGGG - Intronic
1152101790 17:78305755-78305777 CAGTGGGGACAGAGGCTGCAGGG - Intergenic
1152920509 17:83064275-83064297 CAGATGGTGCAGGGGCTGCAGGG - Intergenic
1153571962 18:6482728-6482750 CAGATGGTGCTGAGGCAGCACGG - Intergenic
1153987270 18:10363856-10363878 CAGAAGGTAAAGGGGAAGCAAGG + Intergenic
1156294143 18:35774635-35774657 CAGATGATACAGGGCCTTCTAGG - Intergenic
1157251754 18:46101721-46101743 AAGATGGGGCAGGGGGTGCAGGG - Intronic
1158895795 18:61911716-61911738 CAGCTAGTGCAGGGGCTGCCTGG + Intergenic
1161202692 19:3024831-3024853 CCGCTGGGGCAGGGGCTGCAGGG - Intronic
1161216048 19:3095486-3095508 TGGAGGGTACAGGGCCTGCATGG - Intronic
1161515454 19:4693779-4693801 CAGATGGTGCAGGGCCTGCTGGG - Intronic
1162059432 19:8085850-8085872 CAGAGGGAAGAGGGGCAGCAGGG + Intronic
1162829965 19:13278260-13278282 CAGATCGTGCAGGGGCTTGAGGG - Intronic
1162875310 19:13616917-13616939 CAGATGGTACAGGGTCTTGTGGG + Intronic
1163575935 19:18110698-18110720 GAGGGGCTACAGGGGCTGCAGGG - Intronic
1164763772 19:30747412-30747434 CAGATGGTCAGGGGCCTGCAAGG - Intergenic
1165147456 19:33740415-33740437 CAGATGCCACACAGGCTGCACGG - Intronic
1165509070 19:36255693-36255715 CAGAGGCTTCAGGGGCTGCCTGG + Intergenic
1166068583 19:40374722-40374744 CAGATGGAAGAGAAGCTGCAGGG + Intronic
1167260318 19:48454425-48454447 CAGATGGATCAGAGGCTGGATGG - Exonic
1202704634 1_KI270713v1_random:13845-13867 CAGCTTGTGCAGCGGCTGCAGGG - Intergenic
925133793 2:1512607-1512629 CAGCTGCTTGAGGGGCTGCAGGG - Intronic
925494970 2:4436495-4436517 CAGAAGGTAAAGGGGAAGCAAGG + Intergenic
925848045 2:8051706-8051728 AAGGTGGGACAGGGGCTTCAGGG + Intergenic
927328993 2:21840731-21840753 CAGATAGTAAAGGGGAAGCAAGG - Intergenic
927552194 2:24010252-24010274 CAGCTGGAAAAGGGGCTGCGAGG - Intronic
930314724 2:49784173-49784195 CTGATGTGACAGTGGCTGCACGG + Intergenic
930737589 2:54795253-54795275 CAGAAGGTAAAGGGGAAGCAGGG + Intronic
931333157 2:61309511-61309533 AAGATAGTACAGTGGCAGCAGGG - Intronic
932703804 2:74008351-74008373 CACACAGTACAGGGGCTCCAAGG - Intronic
932947639 2:76255500-76255522 CAGATGGTACAGGGGAGACGTGG - Intergenic
933497407 2:83067026-83067048 CAGAAGGTAAAGGGGAAGCAAGG + Intergenic
933759486 2:85663999-85664021 CAGAGAGTCCAGGGGATGCAGGG + Intronic
934133313 2:88970412-88970434 CACATGGCTCAGAGGCTGCATGG + Intergenic
934555621 2:95285672-95285694 CAGCTGGCCCAGGAGCTGCAAGG + Exonic
934790621 2:97056788-97056810 AAGCTGCTACAGGGGCTCCAGGG - Intergenic
937208111 2:120249811-120249833 CAGATGATGCAGGGGCTTCTCGG - Intronic
937247500 2:120503115-120503137 TAGATGGCACATGGCCTGCAGGG - Intergenic
937436344 2:121884938-121884960 CAGCTGGGAAAGGGGCTGCAGGG - Intergenic
938982553 2:136540315-136540337 CAGATGGTGAAGGGGAAGCAAGG - Intergenic
941112170 2:161427457-161427479 CAGATGGTGGCGGAGCTGCAAGG - Intronic
941812366 2:169767816-169767838 CAGGTAGTACAGCAGCTGCATGG + Intronic
941934856 2:170974358-170974380 CAGAGGGAACAGCGTCTGCAAGG + Intergenic
944505898 2:200410480-200410502 CAGATCGTACAGGGCCTACAAGG - Intronic
948570341 2:238913666-238913688 CAGATGGCACTGGGGCTGCAGGG - Intergenic
948591427 2:239053252-239053274 CAGATGGACCCGGGGCTGCCAGG - Intronic
948998586 2:241597812-241597834 CCCAGGGTGCAGGGGCTGCATGG + Intronic
949046467 2:241874648-241874670 CAGGTGGTGCGGGGGCTTCAAGG + Intergenic
1170352791 20:15460348-15460370 CAGGTGCTACAGGGGTTGGAGGG - Intronic
1170625625 20:18027980-18028002 AATATGGTACTGGGGGTGCATGG + Intronic
1170643333 20:18175418-18175440 CAGATGGGTCAGGGGCTGCTTGG - Intronic
1171155141 20:22865074-22865096 GAAATGGAACAGGGGCAGCAGGG + Intergenic
1171505373 20:25628699-25628721 CAGAAGATAGAGGGGCTGCTGGG - Intergenic
1172331124 20:34076907-34076929 CAGGTGGTCCAGGATCTGCAGGG - Intronic
1172518869 20:35554597-35554619 CAGTTGGTACAGGGTCCCCATGG + Intronic
1172692901 20:36802911-36802933 CAGCTGGTGGAGCGGCTGCAGGG - Exonic
1174193645 20:48757742-48757764 GAGCTGGTCCAGGGGCTACACGG - Intronic
1176114268 20:63424289-63424311 CCCATGGGTCAGGGGCTGCAGGG + Intronic
1176369166 21:6052187-6052209 GAGATGGGACTGGGGCTGCGTGG + Intergenic
1178153560 21:29824722-29824744 GAGATGGTTCAGGGACTGCTAGG + Intronic
1178510665 21:33202402-33202424 CAGGTGGCATAGGGGCTGGAGGG - Intergenic
1179754353 21:43486354-43486376 GAGATGGGACTGGGGCTGCGTGG - Intergenic
1179935261 21:44599977-44599999 CAGATGGAAGAGGGGGTGCACGG + Intronic
1180801143 22:18632499-18632521 CAGAGGGTGGAAGGGCTGCAGGG + Intergenic
1180852373 22:19028058-19028080 CAGAGGGTGGAAGGGCTGCAGGG + Intergenic
1181133001 22:20745084-20745106 CAGACCGTAAAGGGGCTGAAGGG + Intronic
1181220577 22:21362762-21362784 CAGAGGGTGGAAGGGCTGCAGGG - Intergenic
1181609587 22:24003728-24003750 CAGATGGTGCAAGGGCCCCAGGG + Intergenic
1181985268 22:26796279-26796301 GAGATGGCTCAGGGCCTGCAGGG - Intergenic
950904215 3:16522954-16522976 CAGAAGGTGAAGGGGCAGCAGGG + Intergenic
952519501 3:34142395-34142417 CTGATGGAACAAGAGCTGCATGG + Intergenic
954316536 3:49804543-49804565 CAGGTGGTACACTGGCTACAGGG - Exonic
954686249 3:52371845-52371867 CAGAAGGGCCAGGAGCTGCACGG - Intronic
955318634 3:57958977-57958999 GAGATGGTGCAGGGGCTGCATGG + Intergenic
955476119 3:59338023-59338045 CTAATAGTACAGGGGCTACATGG + Intergenic
955875262 3:63482522-63482544 GAGATCTTACAGGGGCTGTACGG - Intronic
956765353 3:72480162-72480184 CAGAAGGTAAAGGGGAAGCAAGG - Intergenic
958883898 3:99704683-99704705 CAGATTGTTCAGAGTCTGCAGGG - Intronic
961380388 3:126492802-126492824 CAGATGGCTCAGGGGCTCCAAGG - Intronic
961543787 3:127618163-127618185 CACAGGGGACAGGTGCTGCAGGG + Intronic
962807656 3:138938686-138938708 CAGCTGGAACAGGCGATGCACGG + Intergenic
965810809 3:172590099-172590121 CAGAAGGTAAAGGGGAAGCAAGG - Intergenic
966236343 3:177705867-177705889 GAGATGGTACAGGGCATGGAAGG + Intergenic
967196983 3:187036249-187036271 CAGATGCTAGGGAGGCTGCAGGG + Intronic
973021745 4:45211354-45211376 CAGATGGTGTTGGGGCTGCAAGG - Intergenic
979101901 4:116627704-116627726 CAGATGTTAGCGAGGCTGCAGGG - Intergenic
979448015 4:120838162-120838184 AAGAAGGTACAGAGGCTGAATGG - Intronic
986284450 5:6349109-6349131 GAGATGGAACAGGCCCTGCAGGG - Intergenic
988708953 5:33754442-33754464 CAGATGGCACAGGAGGTGAAGGG - Intronic
989541905 5:42627902-42627924 CAGATCATACAGGGGCTCGAAGG + Intronic
990891878 5:60659266-60659288 CAGATGTTACGGGGGGTGGAGGG - Intronic
991454447 5:66787616-66787638 CAGATGTTACCTGTGCTGCAGGG + Intronic
993334724 5:86644107-86644129 CAGATGGTAAAGTGGGGGCAAGG - Intergenic
997420107 5:133760085-133760107 GAGATTGTACAGGGCTTGCAAGG + Intergenic
1002059445 5:176617798-176617820 TAGATGGAGGAGGGGCTGCAGGG - Intergenic
1002175285 5:177398120-177398142 GAGGTGGTCCAGGGGCTTCAGGG - Exonic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1002831166 6:822438-822460 CAGAGGCTACAGGAGCTGAAAGG + Intergenic
1003236011 6:4295632-4295654 CAGATCCTACAGGGCCTGAAAGG + Intergenic
1004319599 6:14622042-14622064 CAGATGGTAAATTGGCTGCCAGG + Intergenic
1005939050 6:30547176-30547198 CAGGTGGAGCAGGGCCTGCACGG + Exonic
1006668617 6:35715874-35715896 CTAATGGCACAGGGGCTGGAAGG - Intronic
1006912401 6:37571925-37571947 CAGATGGTGCAAGGGCAGCAGGG - Intergenic
1007354121 6:41298190-41298212 CAGAAGGTAAAGGGGGTACAGGG - Intergenic
1007790831 6:44307208-44307230 CAGAGAGGACAGGGGCTGCTGGG - Intronic
1009607656 6:65895338-65895360 CAGAAGGTAAAGGGGAAGCAAGG + Intergenic
1011613985 6:89181292-89181314 CAGACAGTTCAGGGGCTGCAGGG - Intronic
1012038208 6:94170111-94170133 CAGAAGGCAGAGGGGATGCAAGG + Intergenic
1012592267 6:100996602-100996624 CAGATGGTACAGCTGCAGGAAGG + Intergenic
1017644032 6:156522548-156522570 CAGATGGTGAAGGGGAAGCAAGG - Intergenic
1017726146 6:157277107-157277129 GAGGGGGTGCAGGGGCTGCACGG + Intergenic
1018899198 6:168042809-168042831 CAGGAGGTGCAGGGGGTGCATGG - Intronic
1020255514 7:6500977-6500999 CAGATGGTACAGTGGCTTTGGGG + Intronic
1021386609 7:20038808-20038830 CAGATGGTAGAAGGGCTGTTGGG + Intergenic
1022503447 7:30896613-30896635 CAGATGGTCTTGGGGCTGGATGG + Intergenic
1022525195 7:31032657-31032679 GAGATGGTTCAGGGTCCGCAGGG + Intergenic
1023053981 7:36277179-36277201 CAGGTGGAACAGGGGAGGCAGGG - Intronic
1023528487 7:41129800-41129822 CACATGGTGCAGGGTCTGAAAGG + Intergenic
1027604398 7:80283110-80283132 CAGAAGGTGAAGGGGATGCAAGG - Intergenic
1028675588 7:93456984-93457006 TAGGTGATACAGGAGCTGCAGGG + Intronic
1028928024 7:96381484-96381506 CAGATGGTACCTCTGCTGCATGG - Intergenic
1031730017 7:125288596-125288618 CAGAAGGTGAAGGGGCAGCAAGG - Intergenic
1032894614 7:136236677-136236699 CAGAAGGTGAAGGGGCAGCATGG + Intergenic
1033705406 7:143881698-143881720 GGGATGGTAGAGGGGCTGAATGG - Intronic
1034890357 7:154833918-154833940 TGGATGGTCCCGGGGCTGCACGG + Intronic
1035478337 7:159159493-159159515 CAGATGGAACTGGGTCTCCAGGG - Intergenic
1035747942 8:1974648-1974670 CACATGGGGCGGGGGCTGCAAGG - Intronic
1035907690 8:3531562-3531584 CAGATGGAACCTGGACTGCATGG - Intronic
1036801253 8:11794442-11794464 GAGATGGTACAGAGACAGCAGGG + Intergenic
1037135152 8:15451394-15451416 CAGAGGGGAGAGGGGCTGAAGGG + Intronic
1039399077 8:37253321-37253343 GAGAGGGTCCAGGGGCTCCATGG + Intergenic
1040798998 8:51320835-51320857 CAGATGTTAGAGGGGTTCCAAGG - Exonic
1041277197 8:56174519-56174541 CAGACGGTACAGGGGCAGAGAGG + Intronic
1042265908 8:66909168-66909190 CAGAAGGTAAAGGGGAAGCAAGG - Intronic
1045102670 8:98861155-98861177 GGGCTGGGACAGGGGCTGCAAGG + Intronic
1045476872 8:102560753-102560775 CAGGGGCTGCAGGGGCTGCAAGG - Exonic
1045476874 8:102560762-102560784 CAGGGGCTGCAGGGGCTGCAGGG - Exonic
1045476877 8:102560771-102560793 CAGGGGTTGCAGGGGCTGCAGGG - Exonic
1046706584 8:117460249-117460271 CAGATGATAAATGGGCTTCATGG - Intergenic
1046729010 8:117705213-117705235 CAGATGGAAAAGGGTCTGAAAGG - Intergenic
1048681027 8:136842200-136842222 CAGATGGCACAGGTGCTGTGTGG - Intergenic
1048829839 8:138465318-138465340 CAGATCTCACAGGTGCTGCAAGG + Intronic
1049034404 8:140063002-140063024 CAGAAGGTAAAGGGGAAGCAAGG + Intronic
1049040833 8:140110832-140110854 GAGCTGCTACAGGGGTTGCAGGG - Intronic
1049040876 8:140110958-140110980 GAGCTGCTGCAGGGGCTGCAGGG - Intronic
1049093629 8:140535089-140535111 CAGCTGCTGCAGGGGCCGCATGG - Intronic
1049216647 8:141411405-141411427 CACATGGTGGAGGGGCTGGAGGG - Intronic
1049802416 8:144524129-144524151 CAGACTGGCCAGGGGCTGCAGGG + Exonic
1050025988 9:1335137-1335159 CAGATTCTGCAGGGGCTGCTGGG - Intergenic
1050044874 9:1532482-1532504 CAGAAGGTTCTGAGGCTGCAGGG + Intergenic
1052821507 9:33141149-33141171 CAGGTGGTATAGGGCATGCAGGG + Intronic
1053204078 9:36171739-36171761 CAGAAGGAACAGGGGAGGCAAGG + Intergenic
1055698787 9:78918224-78918246 CAGAAGGTAAAGGGGAAGCAAGG - Intergenic
1057192260 9:93094730-93094752 CAGATGGCGCATGGACTGCAGGG + Intergenic
1057427413 9:94964027-94964049 TAGATGGTACAGAGACTGCCTGG + Intronic
1057729051 9:97593233-97593255 CAGAGGTCACAGGTGCTGCAGGG + Intronic
1057763285 9:97893280-97893302 CAGAGGGTAGAGGGTCTGAAGGG + Intergenic
1058381417 9:104381110-104381132 CAAATAGTACAGGACCTGCATGG + Intergenic
1059311821 9:113393539-113393561 CAGAACGGACTGGGGCTGCATGG + Exonic
1060810560 9:126609667-126609689 CTGATGGGAGAGGGGCTGCAGGG - Intergenic
1060995430 9:127872897-127872919 CAGGAGGAACAGGGGCTGCCAGG + Intronic
1061614502 9:131771008-131771030 CAGAAAGCACAGGTGCTGCAGGG + Intergenic
1062070088 9:134550740-134550762 CAGATGGGACAGGGGCTGCAGGG - Intergenic
1062102059 9:134733538-134733560 CAGAAGGGTCATGGGCTGCAGGG + Intronic
1062460332 9:136660199-136660221 CAGAGGGTACTGGGGGTCCAGGG - Intronic
1062533460 9:137011582-137011604 CAGGTGGGACCGGGGCTGCCTGG - Intronic
1186725116 X:12349166-12349188 CAGCTGGTAGAGGGGCTGTGTGG + Intronic
1187700127 X:21957066-21957088 CATCAGGTAAAGGGGCTGCAAGG - Intronic
1187752555 X:22483539-22483561 CAGATGGTTCTGGGCCTGCACGG + Intergenic
1189851309 X:45178820-45178842 CAGATATTTCAGAGGCTGCATGG + Intronic
1191665804 X:63701201-63701223 CAGATGATCCAGGGGCTGTTTGG - Intronic
1192163421 X:68806675-68806697 CAGAAAGTAGAGGGGCTGCCAGG + Intergenic
1194092608 X:89597821-89597843 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1195251443 X:103051918-103051940 CAGATCTTACAGGGCCTGAAGGG + Intergenic
1195884317 X:109624189-109624211 CAGCTGCTCCAGGGGCTGCCAGG - Exonic
1196207475 X:112957229-112957251 CAGAAGGTAAAGGGGAAGCAAGG - Intergenic
1199896322 X:152130899-152130921 AAGGTGGTAGTGGGGCTGCATGG - Intergenic
1200445255 Y:3253924-3253946 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic