ID: 1132956424

View in Genome Browser
Species Human (GRCh38)
Location 16:2596743-2596765
Sequence CAGGAGCCTGCGCTTGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132956424_1132956431 9 Left 1132956424 16:2596743-2596765 CCACTTCCAAGCGCAGGCTCCTG 0: 1
1: 0
2: 2
3: 18
4: 221
Right 1132956431 16:2596775-2596797 CCTGGCCGTATGTCCTCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 63
1132956424_1132956438 30 Left 1132956424 16:2596743-2596765 CCACTTCCAAGCGCAGGCTCCTG 0: 1
1: 0
2: 2
3: 18
4: 221
Right 1132956438 16:2596796-2596818 GGCAAGGATCTCGGTGCAGGTGG 0: 1
1: 0
2: 2
3: 18
4: 185
1132956424_1132956434 21 Left 1132956424 16:2596743-2596765 CCACTTCCAAGCGCAGGCTCCTG 0: 1
1: 0
2: 2
3: 18
4: 221
Right 1132956434 16:2596787-2596809 TCCTCCGCAGGCAAGGATCTCGG 0: 1
1: 0
2: 0
3: 6
4: 109
1132956424_1132956433 14 Left 1132956424 16:2596743-2596765 CCACTTCCAAGCGCAGGCTCCTG 0: 1
1: 0
2: 2
3: 18
4: 221
Right 1132956433 16:2596780-2596802 CCGTATGTCCTCCGCAGGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 82
1132956424_1132956437 27 Left 1132956424 16:2596743-2596765 CCACTTCCAAGCGCAGGCTCCTG 0: 1
1: 0
2: 2
3: 18
4: 221
Right 1132956437 16:2596793-2596815 GCAGGCAAGGATCTCGGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 150
1132956424_1132956427 -9 Left 1132956424 16:2596743-2596765 CCACTTCCAAGCGCAGGCTCCTG 0: 1
1: 0
2: 2
3: 18
4: 221
Right 1132956427 16:2596757-2596779 AGGCTCCTGGCCTCTGTTCCTGG 0: 1
1: 0
2: 0
3: 27
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132956424 Original CRISPR CAGGAGCCTGCGCTTGGAAG TGG (reversed) Intronic
901765281 1:11496167-11496189 CACAAGCCTGGGCTTGAAAGTGG + Intronic
902052528 1:13575557-13575579 CAAGAGCCAGCCTTTGGAAGAGG + Intergenic
904482775 1:30804603-30804625 CTGGGGCCTGAGCTTGGAAGAGG + Intergenic
904753561 1:32755442-32755464 AAAGAGCCTGGGCTGGGAAGTGG + Intronic
905856130 1:41315499-41315521 AAGGTGCCTGTGCTTGGAGGTGG - Intergenic
906087991 1:43152377-43152399 CAGGAGCCAGCCCTGGGAAGAGG - Intronic
906813324 1:48851423-48851445 CAGGGGCCAGAGCATGGAAGGGG + Intronic
906961638 1:50422716-50422738 CAGGAGCCTGCGCTCGAGAGGGG - Intronic
907837361 1:58123114-58123136 CAGGGGCCAGCTCTAGGAAGGGG - Intronic
912935503 1:114000685-114000707 CAGAACCCTGCACTTAGAAGGGG + Intergenic
913024959 1:114828940-114828962 CAGGAGACTGAGCTGGGAGGAGG - Intergenic
913118572 1:115718835-115718857 GAGGAGCTAGAGCTTGGAAGGGG + Intronic
915002893 1:152609683-152609705 CAGGAGACTGGAGTTGGAAGGGG + Intergenic
916728910 1:167549202-167549224 GAGGAGCCTGGGGTTGGGAGTGG + Intronic
917795168 1:178528117-178528139 CAGAACCCTGCACTTGGCAGGGG + Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918358014 1:183724370-183724392 CAAGAGCCAGGGCTTGGAACTGG - Intronic
921149129 1:212385876-212385898 GAGGTGCCTGGGCTGGGAAGAGG - Intronic
921877798 1:220218853-220218875 CAGGAGCTTGCAGTTGGAATAGG - Intronic
922044373 1:221929040-221929062 CAGGAGCCTGGTCTTGGAGTGGG - Intergenic
922599723 1:226840676-226840698 CAGGAGGCTGAGCTGGGAGGTGG + Intergenic
924793318 1:247272868-247272890 CAGGAGCCAGGGCTTGGAAAAGG + Intergenic
1062923254 10:1295957-1295979 CAGGAGCCTGTGGTTGGACTGGG + Intronic
1066980522 10:42409823-42409845 CAGGAGTCTTCACTTTGAAGTGG + Intergenic
1070338207 10:75473520-75473542 CAGCAGCCTGCATTTGGAGGTGG + Intronic
1071051178 10:81450675-81450697 CAGGAGCCAGGGCTTGGACAGGG + Intergenic
1073128707 10:101170832-101170854 CTTGAGCCTGCGCTGGGAGGAGG - Intergenic
1073321205 10:102617280-102617302 CAGGAGCCTGCCCCTGGAGATGG - Exonic
1073475939 10:103753529-103753551 CAAGAGCTTGGGCTTGGAAGTGG + Intronic
1075670172 10:124259077-124259099 CATGTGGCTGAGCTTGGAAGTGG - Intergenic
1075805347 10:125184696-125184718 CAGCAGCCTGGGTTGGGAAGGGG - Intergenic
1075991701 10:126843725-126843747 CAGGAGCCGACGCTTGGATAAGG + Intergenic
1076902420 10:133346535-133346557 CAGGAGGGAGCGCCTGGAAGGGG + Intronic
1077138397 11:1012870-1012892 CAGCAGCCTGTCCTTGGGAGAGG - Exonic
1077913729 11:6597154-6597176 TAGGAGCCTGCACTGGGAAAGGG + Exonic
1079109856 11:17599243-17599265 CAAGAGCCTTCGGTGGGAAGGGG - Intronic
1083512711 11:63226774-63226796 CAGGAGCCTGGGCTTGGAGTTGG + Intronic
1084088350 11:66865039-66865061 GAAGAGCCAGGGCTTGGAAGTGG + Intronic
1085147386 11:74213348-74213370 CAGGAGCCAGGGCTTGGAATTGG - Intronic
1087370183 11:97274057-97274079 CAGCAGCCTGCGCTCTGGAGGGG - Intergenic
1087370659 11:97279755-97279777 CAGGAGCTAGGGCTTGGAATGGG - Intergenic
1088821089 11:113457961-113457983 CAGCAGCCTGGGCTGGGGAGGGG + Intronic
1090206218 11:124885783-124885805 CAGGAGGATGGGATTGGAAGAGG + Intronic
1090788476 11:130070003-130070025 CAGGAGCCTGCCCGTGGCTGCGG - Exonic
1092305992 12:7301604-7301626 CAGGAGACTTCGCTTGAACGTGG - Intergenic
1096154146 12:49332559-49332581 CTGGAGCCTGAGCCTGAAAGTGG + Exonic
1096774698 12:53956796-53956818 CAGCTGCCTGCGGTTGGCAGGGG + Exonic
1096877045 12:54637531-54637553 CACGTGACTGAGCTTGGAAGTGG + Intergenic
1100631982 12:96399413-96399435 GAGGAGCCCGCGCGTGGGAGCGG - Intronic
1103474024 12:121205145-121205167 AAGGAAGCTGTGCTTGGAAGAGG + Intergenic
1104093283 12:125533671-125533693 CAGGAGCCTCCGCCGGGGAGGGG - Intronic
1104563904 12:129863067-129863089 GAGGAGCTTGGGCTTGGAATTGG + Intronic
1104884774 12:132100373-132100395 CAGGAGCCTGTGCTTGTACCTGG - Intronic
1105431303 13:20339919-20339941 TAGGAGCCTGGGCTTGGTGGCGG + Intergenic
1105828102 13:24140573-24140595 CATGAGACTGAGCTTTGAAGAGG - Intronic
1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG + Intronic
1116495328 14:45553092-45553114 CAGGAGCTAGGGCTTGGAATTGG + Intergenic
1117487503 14:56212998-56213020 CAGGAGCCCTGGCTTAGAAGTGG + Intronic
1118001442 14:61527072-61527094 CAGGTGCTTGTGCTGGGAAGCGG + Intronic
1118271014 14:64342222-64342244 CAGGAGCCTGGGCATGAAACAGG - Intergenic
1119492854 14:75051465-75051487 CACGAGCATGCGCTTCGGAGGGG + Exonic
1119720260 14:76885279-76885301 CAGGAGCCTGAGCTGGGAATGGG - Intergenic
1121321340 14:92993380-92993402 CAGGAGCCTGCAGCTGGCAGGGG + Intronic
1121954838 14:98204483-98204505 CAGGAGACTGGGCTGGGTAGTGG + Intergenic
1122023827 14:98860055-98860077 CAGGTGCCTGGGCTAGGGAGTGG + Intergenic
1122931795 14:104936509-104936531 CAGGAGCCTGGGCAGGGGAGAGG - Exonic
1122982007 14:105196250-105196272 CAGGACCGTGGGCTGGGAAGAGG - Intergenic
1124800857 15:32831519-32831541 CAGGAGCCAGGGCTTTGCAGAGG + Intronic
1124815200 15:32983343-32983365 CAGGAGCCTGAGATCAGAAGAGG + Intronic
1125356548 15:38822419-38822441 CTGGAGCCTAGGCTTGGAAGTGG + Intergenic
1129876825 15:78981022-78981044 CAGGAGCCTGCGCTCAGAGCAGG + Intronic
1130747113 15:86666851-86666873 CAGGACCCTGCAGTTAGAAGTGG + Intronic
1132265623 15:100467964-100467986 CAGGAGCCTGAGGTTGGCGGGGG - Intronic
1132734635 16:1379391-1379413 CCCGAGCCCGCGCTGGGAAGCGG + Intronic
1132956424 16:2596743-2596765 CAGGAGCCTGCGCTTGGAAGTGG - Intronic
1133834096 16:9351166-9351188 CAGGAGCCAGGGCTTGGAGTTGG + Intergenic
1134185249 16:12079896-12079918 CAGGGGCCTGAGCTTGGATAGGG + Intronic
1134909619 16:18012916-18012938 CAGGTGAATGGGCTTGGAAGTGG + Intergenic
1136679236 16:31945891-31945913 CAAGAGCCTACGCCTGGACGTGG - Intergenic
1137270497 16:46899705-46899727 CTGGAGCGTGAGCTTTGAAGGGG + Intronic
1141161282 16:81630684-81630706 CAGGTGGCTGGGCCTGGAAGGGG - Intronic
1142218672 16:88842213-88842235 CAGGAGCCTGCGAAAGGAGGCGG - Intronic
1142263025 16:89051325-89051347 CAGGAGCCTCCACCTTGAAGGGG - Intergenic
1143518138 17:7430155-7430177 TAGGAGCCTGGGCTGGGGAGTGG - Intergenic
1143633548 17:8151897-8151919 CAGGAACCAGCGCTGGGAACGGG + Intronic
1146263630 17:31437315-31437337 CAGGAGCCTAAGCCAGGAAGAGG - Intronic
1147911400 17:43858322-43858344 CAGGAGGCCGGGCTTGGAGGTGG - Intronic
1148127868 17:45246080-45246102 CAGGAGCCTGGGATGGGAAAGGG + Intronic
1148150357 17:45393479-45393501 CAGGAGCCTTCTCCTGCAAGAGG - Intergenic
1148429156 17:47627728-47627750 CAGGAGGCTGAGGTGGGAAGAGG + Intergenic
1148579519 17:48734129-48734151 CCGGAGCCTGCGCTTGGCAGGGG + Intergenic
1148836704 17:50469353-50469375 CAGCTGCCTGCGCTTTAAAGGGG + Intronic
1150424620 17:65067459-65067481 CAGTAGCCAGAGCTTGGCAGGGG + Intergenic
1151479209 17:74360472-74360494 CAAGAGGATGCTCTTGGAAGGGG + Intronic
1152106290 17:78331066-78331088 CAGGAGCCGGCACGTGGTAGTGG - Intergenic
1152513404 17:80805494-80805516 CAGGAGACTCTGCTTGGAGGTGG + Intronic
1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG + Intergenic
1152790056 17:82273850-82273872 CAGGAGCCTGCACGTGGAAGGGG - Intergenic
1153765098 18:8367319-8367341 CAGGTGCCTGTGCTCGGGAGGGG + Intronic
1160109368 18:76011400-76011422 CAGGAGTCTAGGCTTGGAACTGG - Intergenic
1160190512 18:76710926-76710948 CAGATGCCTGCTCTTGGCAGGGG + Intergenic
1160936815 19:1600021-1600043 CAAGAGCATGAGCTTGGAACCGG - Intronic
1161704506 19:5812822-5812844 CAGGAGGCTGCCCTAGGAACAGG + Intergenic
1163517474 19:17773846-17773868 GGGGAGACTGCGCTTGGAAAGGG - Intronic
1164522355 19:28989115-28989137 CATAAGCCTGGGCTTGGAGGTGG + Intergenic
1165645363 19:37431392-37431414 CAGGAGCTAGCGCATGGAATGGG - Intronic
1166832059 19:45644998-45645020 AAGGAACCTGGGATTGGAAGGGG - Intronic
1167328308 19:48838047-48838069 CAGTAGCCAGGGCTTGGGAGAGG + Exonic
925141199 2:1550836-1550858 CAGGTGCCCGCGCTTGGGAGCGG - Intergenic
925276342 2:2650984-2651006 CAGGATCCTGCCCTTGGCATCGG - Intergenic
927929244 2:27033487-27033509 CAGGTGTCTGAGCTTTGAAGAGG + Intronic
932333247 2:70912835-70912857 CAAGAGCCTTTGCTTGGGAGAGG - Intronic
932667318 2:73708145-73708167 CAAGAGCCTGCACGTGGGAGGGG - Intergenic
934937783 2:98477781-98477803 CAGGAGACAGCGGTTGGATGAGG + Intronic
935944046 2:108270095-108270117 CAGGAGCCTGTGCATGGTAAAGG + Intergenic
936013659 2:108942058-108942080 CCGGAACCTGTGTTTGGAAGTGG + Intronic
936064779 2:109322405-109322427 CAGGAGCCTGAACTAGGAGGCGG + Intronic
936514549 2:113173696-113173718 CAGGGGCCTGGGATTGAAAGGGG - Intronic
936714367 2:115168055-115168077 CAGGAGAGTGTGCTTGGCAGTGG + Intronic
942623691 2:177876311-177876333 CAGGAGCCTGGGGTTGACAGAGG - Intronic
944616459 2:201465392-201465414 CAGGAGCTAGGGCTTGGAATGGG + Intronic
944872988 2:203932987-203933009 AAGGAGCATGTGCTTGGAAGAGG - Intergenic
946840383 2:223813910-223813932 CAGGAGCTTAAGCTTGGAATAGG - Intronic
947523755 2:230866279-230866301 CAGAAGCCTGCATCTGGAAGTGG - Intronic
948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG + Intronic
948570195 2:238912987-238913009 CAGGAGCCAGCACAGGGAAGTGG - Intergenic
948622423 2:239244748-239244770 CAGGAGGCTGAGCTGGGAGGAGG - Intronic
948674465 2:239588876-239588898 CAGGGCCCTGCGCAGGGAAGAGG - Intergenic
948903884 2:240968811-240968833 GAGGAGCCTGGGCCTGGAAATGG + Intronic
948909641 2:240996603-240996625 CAGGAGCATGTGGTGGGAAGTGG + Intergenic
1170864147 20:20138048-20138070 CAGGAGCCAGGGCCTGGAATAGG + Intronic
1171113372 20:22503666-22503688 CAGGGGCCAGCGCTGGGGAGGGG + Intergenic
1172191741 20:33065887-33065909 CAGGACCCTGAGCTGGGGAGAGG + Intronic
1172367769 20:34363227-34363249 CAGGCGCCTGAGCGCGGAAGTGG - Intronic
1172625235 20:36342932-36342954 CAAGGGCCTGAGCTTGGAGGTGG + Intronic
1172786395 20:37471636-37471658 CCTGAGCCTGCGCTTGCAATGGG - Intergenic
1173301629 20:41808822-41808844 CAGGAGGCAGAGCTTGGAGGCGG - Intergenic
1173347703 20:42216036-42216058 CAGGAGACGCTGCTTGGAAGCGG - Intronic
1173575613 20:44111438-44111460 CAAGAGCCTGCCCTTTGAGGTGG - Intergenic
1174681718 20:52415098-52415120 CAGAGTCCTGCACTTGGAAGTGG + Intergenic
1174682062 20:52418060-52418082 CATGGGACTGAGCTTGGAAGGGG - Intergenic
1175886681 20:62295906-62295928 CAGGAGCCTGGTCCTAGAAGAGG - Exonic
1176213921 20:63939395-63939417 TGGGGGCCTGCGCTTGGAGGCGG - Intergenic
1178642772 21:34359517-34359539 CAGGAGGCTGAGGTGGGAAGAGG - Intergenic
1179826942 21:43971534-43971556 CATGAGCTTGCGCTGGGCAGAGG + Intronic
1179917416 21:44486470-44486492 CAGGTGCCCGAGCTGGGAAGGGG - Intergenic
1180174986 21:46083015-46083037 GAGGGACCTGAGCTTGGAAGAGG + Intergenic
1180258637 21:46651190-46651212 CAGGAGCCAGGGCTTGGCATGGG + Intronic
1181018583 22:20086038-20086060 CACGGGGCAGCGCTTGGAAGGGG - Exonic
1181173640 22:21023838-21023860 GAGGAGCCTGAGCTGGGCAGGGG - Intronic
1181448938 22:23003135-23003157 AAGGAAAGTGCGCTTGGAAGAGG - Intergenic
1181806823 22:25379929-25379951 CATGAGAATGAGCTTGGAAGTGG + Intronic
1182576979 22:31279451-31279473 CAGCAGCTTGGGCTGGGAAGAGG + Intronic
1183472147 22:38015332-38015354 CAGGAGCCCCTGCTTGGCAGAGG + Intronic
1184777847 22:46632193-46632215 CACGAGGCTGGGCTGGGAAGGGG + Intronic
1185044992 22:48524320-48524342 CATGAGCCTGCACCTGAAAGAGG - Intronic
1185326763 22:50229493-50229515 CAGCAGCCTGCTCTCGGAAGTGG - Exonic
953837638 3:46361124-46361146 CAAGAGGCTCCGCTTGGATGAGG - Intergenic
954078350 3:48197424-48197446 CAGGGGCCTGGGTTAGGAAGAGG - Intergenic
955077937 3:55631406-55631428 CAGGAGATTGCCCTTGGAGGAGG + Intronic
955441055 3:58955892-58955914 CAGGAGCCAGGGCCTGGAAAGGG - Intronic
957942795 3:87026342-87026364 AAGGAGCATGCAATTGGAAGAGG + Intergenic
962210943 3:133477096-133477118 CAAGAGCCTGTGCTGGGAACTGG - Intergenic
962345765 3:134618158-134618180 TAGGTGCCTGTGCTTGGCAGTGG + Intronic
963156407 3:142102063-142102085 CTGGAGCCTGGGCTTTGAAATGG + Intronic
964965047 3:162481863-162481885 CAGGAGCCGATGCTTGGAATTGG + Intergenic
966856428 3:184196943-184196965 CAGGAGCATGGCCTTGGGAGAGG + Intronic
967540710 3:190664540-190664562 CATGTACCTGCCCTTGGAAGTGG - Intergenic
967673021 3:192261413-192261435 CAGAAGCCTGTGGTTGGAAACGG - Intronic
968526214 4:1058890-1058912 CAGGAGCCAAGGCTTGGGAGAGG - Intronic
968653608 4:1769499-1769521 CAGGAGCCTGGGGTTTGCAGCGG + Intergenic
969043225 4:4317483-4317505 CAGGGGCCAGGGCTGGGAAGGGG - Intronic
971758283 4:30730854-30730876 CTGGAGCCTGCCCTTGGCCGTGG + Exonic
973763257 4:54140000-54140022 CAAGAGCCTAGGCTTGGACGTGG - Intronic
974292346 4:59948657-59948679 CAGGAGCCAGGGCCTGGAATGGG - Intergenic
981518398 4:145634849-145634871 CAGGAGCTAGGGCCTGGAAGGGG + Intronic
981895609 4:149795775-149795797 CAGGAGCTAGGGCTTGGAAAGGG - Intergenic
984586315 4:181568793-181568815 GACGAGCCTGCTCTTGGGAGTGG - Intergenic
985548417 5:521273-521295 CAGGAGCCTGGGCAAGGAACAGG - Intronic
986478299 5:8158503-8158525 CAGGAACCTGCACTTGGGAGGGG - Intergenic
991942007 5:71862349-71862371 CTGGAGCCTGGGCTGGCAAGAGG + Intergenic
991953107 5:71965936-71965958 CAGGAGCCAGGGGATGGAAGGGG - Intergenic
994478297 5:100299054-100299076 CAAGAGAATGAGCTTGGAAGTGG + Intergenic
996612052 5:125393881-125393903 CATGTGCATGAGCTTGGAAGTGG + Intergenic
996972512 5:129389084-129389106 CAGAAGAGTGGGCTTGGAAGTGG + Intergenic
997396305 5:133562652-133562674 CGGGAGCCAGCGCTGGGAGGTGG + Intronic
1000203312 5:159033130-159033152 CAGGAGCAGCCGCCTGGAAGCGG + Intronic
1001844536 5:174910303-174910325 CAGAAGCCTGGGCTGGGGAGTGG - Intergenic
1002591310 5:180292746-180292768 GAGGAGACTGCGCTTGGTGGCGG + Intergenic
1004541062 6:16550318-16550340 CAGGAGCATGTGGTTGGAAGAGG - Intronic
1006417949 6:33915970-33915992 CAGGAGACTGGGCTGGGAACAGG + Intergenic
1010931318 6:81807133-81807155 TTGGAGCCTGGGCTTAGAAGTGG + Intergenic
1013633198 6:112005087-112005109 CAGGAGAATGAGCATGGAAGTGG - Intergenic
1016916201 6:149246770-149246792 CAGGAGGCTGAGCTGGGAGGAGG - Intronic
1019494845 7:1332901-1332923 CAGGAGCCTGGGCTTGGACCCGG + Intergenic
1019538392 7:1540473-1540495 GAGGGGCCTGCGCTTGGACTCGG - Exonic
1019750496 7:2726061-2726083 CAGGAGGCTTTGCTTTGAAGAGG - Intronic
1021923106 7:25506539-25506561 CAGGAGCCAGGGCCTGGAATTGG - Intergenic
1023417874 7:39949799-39949821 CAGGAGCCTCCTCGTGGAGGGGG + Intergenic
1024874409 7:54005325-54005347 CATCAGCCTGGGCTTAGAAGTGG - Intergenic
1026030612 7:66789914-66789936 CAGTTGCCAGCACTTGGAAGAGG + Intronic
1027207511 7:76113314-76113336 CAGTTGCCAGCACTTGGAAGAGG - Intergenic
1028738003 7:94239870-94239892 CAGGAGCCTGAGCTGGGAGGAGG + Intergenic
1029437288 7:100570354-100570376 CAGCAGCCTGCGCGTGGCGGCGG + Intergenic
1030662700 7:112238756-112238778 CAGGAGCCAGGGCCTGGAATGGG - Intronic
1030891132 7:115000984-115001006 CAGAGTCCTGTGCTTGGAAGGGG - Intronic
1032082985 7:128869397-128869419 AAGGAGCCTGCGCGGGGCAGGGG - Intronic
1032138720 7:129307232-129307254 CAGGAGCCAGCGCTTGGAGTTGG + Intronic
1033252567 7:139773759-139773781 GAGGAGCCTCCCCTTGGAGGAGG + Intronic
1035391405 7:158507137-158507159 CAGGACCCAGGGCTTGGATGTGG + Intronic
1037467109 8:19171861-19171883 CTGGAGCCTGGCCTAGGAAGTGG - Intergenic
1037561492 8:20078928-20078950 CAGGAGCCTTGGTTTGGAACAGG + Intergenic
1043876605 8:85492977-85492999 CAGGAGCCTGCAGGTGCAAGTGG + Intergenic
1043929523 8:86075048-86075070 CACGTGCATGCACTTGGAAGGGG - Intronic
1045978883 8:108160891-108160913 CAGAAACCTGGGCTTGCAAGTGG - Intergenic
1047907835 8:129491976-129491998 CATGAGAATGAGCTTGGAAGTGG - Intergenic
1047933589 8:129753348-129753370 CAGGAGCTAGGGCTTGGAATGGG - Intronic
1053513137 9:38706552-38706574 AAGGGGCCGGCTCTTGGAAGGGG - Intergenic
1055398879 9:75901903-75901925 CAGGAGCCTGAGATTAGAAAAGG + Intronic
1059672745 9:116506850-116506872 AAGGAACCTGGGCTTGGACGTGG + Intronic
1060018432 9:120107503-120107525 CAAGAGCATGTGCTAGGAAGTGG + Intergenic
1061550842 9:131333919-131333941 CTGGAACCTGGGCTGGGAAGAGG + Intergenic
1061821281 9:133228328-133228350 CAGGAGTCTGGGCTGGGAGGGGG - Intergenic
1062279819 9:135746925-135746947 CAGGAGCCTGAGGTTGGTGGGGG + Intronic
1062389716 9:136329127-136329149 CAGGAGCCAGCCCCTGGCAGGGG + Intronic
1062463714 9:136672248-136672270 CAGGAGCCTAGGGTTGGATGAGG - Exonic
1062630577 9:137461409-137461431 CTGGAGCCTGGGCGTGGACGTGG + Intronic
1186664290 X:11702744-11702766 CAGCAGCTTGGGCTAGGAAGAGG - Intergenic
1186695437 X:12025784-12025806 CAGGAGTGTGAACTTGGAAGTGG + Intergenic
1187652111 X:21420682-21420704 CAGGAGCTTGGGCCTGGAAAGGG + Intronic
1188668335 X:32852240-32852262 CAGGAGCCAGGGCCTGGAATGGG - Intronic
1190967133 X:55311604-55311626 CAGTAGCCTGCCCTTGCAAGGGG + Intergenic
1192304483 X:69944469-69944491 CAGGAGCCAGGGCCTGGAATGGG + Intronic
1192436140 X:71145025-71145047 GAGGAGCCTGGGATTGGGAGGGG - Intronic
1192534095 X:71912702-71912724 CAGGAGCCTCTGCATGGCAGGGG + Intergenic
1194419045 X:93649817-93649839 CAGGAGCCTGCTTTGGGAAAGGG + Intergenic
1195199308 X:102532642-102532664 CAGGAGCCAGGGCCTGGAATGGG - Intergenic
1195596623 X:106698698-106698720 CTGGAGATTGGGCTTGGAAGGGG - Intronic
1197361170 X:125505080-125505102 CAGGAGCTAGGGCTTGGAAAGGG + Intergenic
1198118926 X:133571697-133571719 CAGTGGCCTGAGCTTGGGAGGGG + Intronic
1198744822 X:139879003-139879025 CAGGAGGCTGAGCTGGGAGGAGG + Intronic
1198799839 X:140437614-140437636 CAAGACCCTGTGGTTGGAAGGGG - Intergenic