ID: 1132956669

View in Genome Browser
Species Human (GRCh38)
Location 16:2598015-2598037
Sequence TCCGTGTGCCCTCGTTGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132956669 Original CRISPR TCCGTGTGCCCTCGTTGCCG TGG Exonic
900392626 1:2440305-2440327 GCGGTGTGCCCTGGCTGCCGGGG + Intronic
910669905 1:89762558-89762580 TCCGTGTGCCCGCTCTGCAGGGG - Intronic
915395797 1:155583060-155583082 GCAGTGTGGCCACGTTGCCGAGG + Intergenic
918392261 1:184078556-184078578 TCAGTGTGCCCTCTGTGCTGGGG + Intergenic
920515147 1:206579832-206579854 TCCGTGAGCCCTCGTGGCTGTGG + Intronic
1076859703 10:133134961-133134983 TCCGTGTGCCCAGGTGGCGGCGG + Intergenic
1088849115 11:113690808-113690830 TCCCTGGGCCCTCGGTGCAGGGG - Intronic
1090400053 11:126443273-126443295 TCCGAGTGCCCTGGCTGGCGCGG + Intronic
1101918709 12:108915843-108915865 GCCGAGGGCCCGCGTTGCCGTGG + Exonic
1106308664 13:28534567-28534589 TCCCTGTGCCCTCCCTGCAGTGG - Intergenic
1119035973 14:71231026-71231048 TCCTTGTGCCCTCCTTGCAGTGG - Intergenic
1126686479 15:51252692-51252714 TCCGTGTGCCCTCCATGCACTGG - Intronic
1132956669 16:2598015-2598037 TCCGTGTGCCCTCGTTGCCGTGG + Exonic
1136957556 16:34803436-34803458 TCTTTGTGCCCCCGCTGCCGCGG + Intergenic
1137247121 16:46714776-46714798 TCCGTGTGCCCTCATTCTCATGG - Intronic
1151557878 17:74855771-74855793 TCAGTGTGCCCTGCTTGCCATGG + Intronic
1152455731 17:80415116-80415138 GCCGTCCGCCCTCGTTGCCATGG - Intergenic
1160511965 18:79457855-79457877 TCCATGTTCCCTCGTTGGTGTGG + Intronic
1162552625 19:11366017-11366039 TCCTTGTGCCCTCTGTGCCCTGG - Intergenic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
925891908 2:8441138-8441160 GCCGTGTGCCATCTTTGCAGTGG - Intergenic
926953903 2:18272383-18272405 TCCATGTGCCCTCCCTGCAGTGG + Intronic
937222530 2:120349940-120349962 ACCGTGTACCCCCGTTCCCGCGG - Exonic
944619993 2:201504662-201504684 TCACTGTGCCCTCCTTGCCCAGG + Intronic
946361196 2:219220236-219220258 CCCGTGTGCCCTCGGTTCCTAGG + Exonic
1171767474 20:29297955-29297977 TCTCTGTGCCCTCCCTGCCGAGG - Intergenic
1173626385 20:44476011-44476033 TCCGTGTGCCCTGGGAGCTGAGG + Intronic
1173803903 20:45911812-45911834 TGCGCGTGCAGTCGTTGCCGTGG - Exonic
1179059386 21:37965558-37965580 TCAGTCTGCCCTTGCTGCCGGGG + Intronic
1179605557 21:42513598-42513620 CCCGTGCGCCCTCGGAGCCGGGG + Intronic
1183011978 22:34954264-34954286 TCCCTGTGCCCTGGTTGCTGCGG - Intergenic
953209892 3:40866527-40866549 CCTGTGTGCCCTGGTTGCCTTGG - Intergenic
956462559 3:69485849-69485871 TCCCTGTGCCCTCCCTGCAGTGG + Intronic
969606913 4:8206404-8206426 TCCTTGTGCACTCGTGGCCCTGG - Intronic
972371181 4:38424745-38424767 TCCGGATGCCCTGGTTGGCGAGG - Intergenic
985366630 4:189237735-189237757 TCTGTGTCCCCTCGCTGCCTTGG + Intergenic
985927299 5:3028201-3028223 TCCCTGCGCACTCGTGGCCGTGG + Intergenic
998200286 5:140113561-140113583 TCGGTGTCCCCTCTTTGCAGGGG + Intronic
999353511 5:150901780-150901802 TCCTTGTGGCCTGGTTGCCTGGG - Intronic
1002879952 6:1242449-1242471 TTCCTGTGCCCTAGTTGCAGGGG - Intergenic
1006365118 6:33610772-33610794 TCTGAGTGCCCTGGTTGCCTCGG + Intergenic
1020565167 7:9786574-9786596 TCATTGTGCCCTCCTTGCCCAGG + Intergenic
1030690118 7:112523860-112523882 CCTGTGTGCCCTGATTGCCGAGG - Intergenic
1033506506 7:142007924-142007946 TCTGTGTGCCCTTGCTGCTGGGG + Intronic
1035302058 7:157903952-157903974 TCCATGTGCCCTCGTGACAGCGG + Intronic
1045406889 8:101875474-101875496 TCCGTGTCCCCTGGTTACTGGGG + Intronic
1050151571 9:2622830-2622852 TCCGGGTGCCCTCGGCTCCGCGG - Intronic
1053351870 9:37418503-37418525 TCCGTGTCCCCTCCTGGCCCTGG - Intergenic
1062155738 9:135047139-135047161 TGTGTGTGCCCTCCTTGCTGGGG - Intergenic
1185431681 X:14871-14893 TCCGTGTCCACTCATGGCCGGGG + Intergenic
1189534488 X:41923093-41923115 CCCGCGAGCCCTCGGTGCCGAGG + Intronic
1198229655 X:134676914-134676936 TCCCTGTGCCTTCGTTTCCTTGG + Intronic