ID: 1132959751

View in Genome Browser
Species Human (GRCh38)
Location 16:2615212-2615234
Sequence AGGAACCCACATATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132959751_1132959757 -8 Left 1132959751 16:2615212-2615234 CCATGTCCCATATGTGGGTTCCT No data
Right 1132959757 16:2615227-2615249 GGGTTCCTCTGGGATCCTGGAGG No data
1132959751_1132959762 23 Left 1132959751 16:2615212-2615234 CCATGTCCCATATGTGGGTTCCT No data
Right 1132959762 16:2615258-2615280 CCACCCATGAGGAAGCCCTGAGG No data
1132959751_1132959760 12 Left 1132959751 16:2615212-2615234 CCATGTCCCATATGTGGGTTCCT No data
Right 1132959760 16:2615247-2615269 AGGAATGAAGACCACCCATGAGG No data
1132959751_1132959765 27 Left 1132959751 16:2615212-2615234 CCATGTCCCATATGTGGGTTCCT No data
Right 1132959765 16:2615262-2615284 CCATGAGGAAGCCCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132959751 Original CRISPR AGGAACCCACATATGGGACA TGG (reversed) Intergenic
No off target data available for this crispr