ID: 1132966670

View in Genome Browser
Species Human (GRCh38)
Location 16:2659831-2659853
Sequence GTAGTGCTGCAGTTCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132966670_1132966677 13 Left 1132966670 16:2659831-2659853 CCCACACAGAACTGCAGCACTAC No data
Right 1132966677 16:2659867-2659889 CAAGTCCATTTCCACAGAAGGGG No data
1132966670_1132966676 12 Left 1132966670 16:2659831-2659853 CCCACACAGAACTGCAGCACTAC No data
Right 1132966676 16:2659866-2659888 CCAAGTCCATTTCCACAGAAGGG No data
1132966670_1132966674 11 Left 1132966670 16:2659831-2659853 CCCACACAGAACTGCAGCACTAC No data
Right 1132966674 16:2659865-2659887 TCCAAGTCCATTTCCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132966670 Original CRISPR GTAGTGCTGCAGTTCTGTGT GGG (reversed) Intergenic
No off target data available for this crispr