ID: 1132966929

View in Genome Browser
Species Human (GRCh38)
Location 16:2661544-2661566
Sequence ACTTAAAGAGCAAATCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132966929_1132966930 -7 Left 1132966929 16:2661544-2661566 CCTCAAAGATTTGCTCTTTAAGT No data
Right 1132966930 16:2661560-2661582 TTTAAGTTGTGAAATATCCAAGG No data
1132966929_1132966932 11 Left 1132966929 16:2661544-2661566 CCTCAAAGATTTGCTCTTTAAGT No data
Right 1132966932 16:2661578-2661600 CAAGGTTAAGTTATCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132966929 Original CRISPR ACTTAAAGAGCAAATCTTTG AGG (reversed) Intergenic