ID: 1132967183

View in Genome Browser
Species Human (GRCh38)
Location 16:2663875-2663897
Sequence ATTTGGGCCACTTGTGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132967183_1132967185 -9 Left 1132967183 16:2663875-2663897 CCCGTTTCACAAGTGGCCCAAAT No data
Right 1132967185 16:2663889-2663911 GGCCCAAATAAAATGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132967183 Original CRISPR ATTTGGGCCACTTGTGAAAC GGG (reversed) Intergenic
No off target data available for this crispr