ID: 1132967185

View in Genome Browser
Species Human (GRCh38)
Location 16:2663889-2663911
Sequence GGCCCAAATAAAATGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132967181_1132967185 9 Left 1132967181 16:2663857-2663879 CCATGAGCTGTACTTTCGCCCGT No data
Right 1132967185 16:2663889-2663911 GGCCCAAATAAAATGAGAAAAGG No data
1132967183_1132967185 -9 Left 1132967183 16:2663875-2663897 CCCGTTTCACAAGTGGCCCAAAT No data
Right 1132967185 16:2663889-2663911 GGCCCAAATAAAATGAGAAAAGG No data
1132967184_1132967185 -10 Left 1132967184 16:2663876-2663898 CCGTTTCACAAGTGGCCCAAATA No data
Right 1132967185 16:2663889-2663911 GGCCCAAATAAAATGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132967185 Original CRISPR GGCCCAAATAAAATGAGAAA AGG Intergenic
No off target data available for this crispr