ID: 1132968448

View in Genome Browser
Species Human (GRCh38)
Location 16:2673106-2673128
Sequence GTCTGTCAGCGCCCCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132968430_1132968448 27 Left 1132968430 16:2673056-2673078 CCACCCCGCTGGGCCGGGTGACA No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968442_1132968448 -9 Left 1132968442 16:2673092-2673114 CCCGCCCTCCGCGCGTCTGTCAG No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968441_1132968448 -8 Left 1132968441 16:2673091-2673113 CCCCGCCCTCCGCGCGTCTGTCA No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968438_1132968448 0 Left 1132968438 16:2673083-2673105 CCGGCCTCCCCCGCCCTCCGCGC No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968433_1132968448 22 Left 1132968433 16:2673061-2673083 CCGCTGGGCCGGGTGACACCTCC No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968440_1132968448 -7 Left 1132968440 16:2673090-2673112 CCCCCGCCCTCCGCGCGTCTGTC No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968439_1132968448 -4 Left 1132968439 16:2673087-2673109 CCTCCCCCGCCCTCCGCGCGTCT No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968432_1132968448 23 Left 1132968432 16:2673060-2673082 CCCGCTGGGCCGGGTGACACCTC No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968431_1132968448 24 Left 1132968431 16:2673059-2673081 CCCCGCTGGGCCGGGTGACACCT No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968435_1132968448 14 Left 1132968435 16:2673069-2673091 CCGGGTGACACCTCCCGGCCTCC No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968436_1132968448 4 Left 1132968436 16:2673079-2673101 CCTCCCGGCCTCCCCCGCCCTCC No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968443_1132968448 -10 Left 1132968443 16:2673093-2673115 CCGCCCTCCGCGCGTCTGTCAGC No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data
1132968437_1132968448 1 Left 1132968437 16:2673082-2673104 CCCGGCCTCCCCCGCCCTCCGCG No data
Right 1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132968448 Original CRISPR GTCTGTCAGCGCCCCCGGCC AGG Intergenic
No off target data available for this crispr