ID: 1132968828

View in Genome Browser
Species Human (GRCh38)
Location 16:2674908-2674930
Sequence CTGTGTCTCCAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132968828_1132968833 -1 Left 1132968828 16:2674908-2674930 CCCTCTGCCCTCTGGAGACACAG No data
Right 1132968833 16:2674930-2674952 GAGAAACCTCCCCACTGGTCAGG No data
1132968828_1132968832 -6 Left 1132968828 16:2674908-2674930 CCCTCTGCCCTCTGGAGACACAG No data
Right 1132968832 16:2674925-2674947 ACACAGAGAAACCTCCCCACTGG No data
1132968828_1132968841 30 Left 1132968828 16:2674908-2674930 CCCTCTGCCCTCTGGAGACACAG No data
Right 1132968841 16:2674961-2674983 CCCATCCTAGGACACCACACAGG No data
1132968828_1132968838 18 Left 1132968828 16:2674908-2674930 CCCTCTGCCCTCTGGAGACACAG No data
Right 1132968838 16:2674949-2674971 CAGGTCCAGCTGCCCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132968828 Original CRISPR CTGTGTCTCCAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr